| Sequence ID | dm3.chrX |
|---|---|
| Location | 13,563,335 – 13,563,406 |
| Length | 71 |
| Max. P | 0.994500 |
| Location | 13,563,335 – 13,563,406 |
|---|---|
| Length | 71 |
| Sequences | 4 |
| Columns | 76 |
| Reading direction | forward |
| Mean pairwise identity | 67.34 |
| Shannon entropy | 0.52083 |
| G+C content | 0.31348 |
| Mean single sequence MFE | -15.52 |
| Consensus MFE | -9.56 |
| Energy contribution | -9.12 |
| Covariance contribution | -0.44 |
| Combinations/Pair | 1.62 |
| Mean z-score | -2.16 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.71 |
| SVM RNA-class probability | 0.994500 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13563335 71 + 22422827 ---UAUUUUAAGAUUUGUAUUCAUAAAUUUGGUAUUUUGAAAGUGCGCCU--UUUUGGCGCAUGCGCUGUUUGAUC ---..(((((((((......(((......))).)))))))))(((((((.--....)))))))............. ( -16.10, z-score = -1.51, R) >droSim1.chrX 10390958 74 + 17042790 UACCUUUUUAAGAUUUGUAUUUAUAAAUAUGGUAUUUUGAAAGUGCGCCU--UUUGGGCGCAUGCGCUCUUUAAUC .....((((((((((..((((....))))..).)))))))))(((((((.--....)))))))............. ( -19.20, z-score = -2.72, R) >droSec1.super_20 203437 74 + 1148123 UACUUUUUUAAGAUUUGUAUUUAUAAAUAUGGUAUUUUGAAAGUGCGCCC--UUUGGUCGCAUGCGCUCUUUAAUC .....((((((((((..((((....))))..).)))))))))(((((((.--...)).)))))............. ( -14.40, z-score = -1.54, R) >droAna3.scaffold_13334 485412 67 + 1562580 --------CGUAUUUUUUCAUCAUAA-UUUAUUAUGGGGAAAUUGCAUAAAAUUAUUGUGCAUACAAAACUCAAUC --------.(((...((((..(((((-....)))))..)))).(((((((.....))))))))))........... ( -12.40, z-score = -2.86, R) >consensus ___UUUUUUAAGAUUUGUAUUCAUAAAUAUGGUAUUUUGAAAGUGCGCCU__UUUGGGCGCAUGCGCUCUUUAAUC ..........................................((((((((.....))))))))............. ( -9.56 = -9.12 + -0.44)
| Location | 13,563,335 – 13,563,406 |
|---|---|
| Length | 71 |
| Sequences | 4 |
| Columns | 76 |
| Reading direction | reverse |
| Mean pairwise identity | 67.34 |
| Shannon entropy | 0.52083 |
| G+C content | 0.31348 |
| Mean single sequence MFE | -9.53 |
| Consensus MFE | -7.38 |
| Energy contribution | -7.50 |
| Covariance contribution | 0.13 |
| Combinations/Pair | 1.43 |
| Mean z-score | -0.94 |
| Structure conservation index | 0.77 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.24 |
| SVM RNA-class probability | 0.914441 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13563335 71 - 22422827 GAUCAAACAGCGCAUGCGCCAAAA--AGGCGCACUUUCAAAAUACCAAAUUUAUGAAUACAAAUCUUAAAAUA--- ..............((((((....--.))))))..((((((((.....)))).))))................--- ( -11.40, z-score = -1.89, R) >droSim1.chrX 10390958 74 - 17042790 GAUUAAAGAGCGCAUGCGCCCAAA--AGGCGCACUUUCAAAAUACCAUAUUUAUAAAUACAAAUCUUAAAAAGGUA .......(((.(..((((((....--.))))))).)))....((((...((((.............))))..)))) ( -11.52, z-score = -1.15, R) >droSec1.super_20 203437 74 - 1148123 GAUUAAAGAGCGCAUGCGACCAAA--GGGCGCACUUUCAAAAUACCAUAUUUAUAAAUACAAAUCUUAAAAAAGUA .....((((.....((((.((...--.))))))......(((((...)))))...........))))......... ( -7.30, z-score = 0.09, R) >droAna3.scaffold_13334 485412 67 - 1562580 GAUUGAGUUUUGUAUGCACAAUAAUUUUAUGCAAUUUCCCCAUAAUAAA-UUAUGAUGAAAAAAUACG-------- ...........(((((((.((.....)).)))..((((..(((((....-)))))..))))..)))).-------- ( -7.90, z-score = -0.81, R) >consensus GAUUAAAGAGCGCAUGCGCCAAAA__AGGCGCACUUUCAAAAUACCAAAUUUAUAAAUACAAAUCUUAAAAAA___ ..............(((((((.....)))))))........................................... ( -7.38 = -7.50 + 0.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:40:48 2011