| Sequence ID | dm3.chrX |
|---|---|
| Location | 13,476,540 – 13,476,597 |
| Length | 57 |
| Max. P | 0.987420 |
| Location | 13,476,540 – 13,476,597 |
|---|---|
| Length | 57 |
| Sequences | 4 |
| Columns | 57 |
| Reading direction | forward |
| Mean pairwise identity | 97.37 |
| Shannon entropy | 0.04270 |
| G+C content | 0.42544 |
| Mean single sequence MFE | -16.25 |
| Consensus MFE | -14.66 |
| Energy contribution | -14.47 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.11 |
| Structure conservation index | 0.90 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.07 |
| SVM RNA-class probability | 0.884579 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13476540 57 + 22422827 AUGUAAUUGGUUGGGGCCAGAUAAAGUUGUGACCCCGAUUUAGAUGGUGCAAAAUAG .((((...((((((((.((.(......).)).)))))))).......))))...... ( -14.40, z-score = -1.64, R) >droEre2.scaffold_4690 5342357 57 - 18748788 AUGUAAUUGGUUGGGGCCAGAUAAAGUUGUGGCCCCAAUUUAGAUGGUGCAAAAUGG .((((...(((((((((((.(......).))))))))))).......))))...... ( -21.80, z-score = -3.52, R) >droYak2.chrX 7758192 57 + 21770863 AUGUAAUUGGUUGGGGCCAGAUAAAGUUGUGACCCCGAUUUAGAUGGUGCAAAAUAG .((((...((((((((.((.(......).)).)))))))).......))))...... ( -14.40, z-score = -1.64, R) >droSec1.super_20 108979 57 + 1148123 AUGUAAUUGGUUGGGGCCAGAUAAAGUUGUGACCCCGAUUUAGAUGGUGCAAAAUAG .((((...((((((((.((.(......).)).)))))))).......))))...... ( -14.40, z-score = -1.64, R) >consensus AUGUAAUUGGUUGGGGCCAGAUAAAGUUGUGACCCCGAUUUAGAUGGUGCAAAAUAG .((((...((((((((.((.(......).)).)))))))).......))))...... (-14.66 = -14.47 + -0.19)
| Location | 13,476,540 – 13,476,597 |
|---|---|
| Length | 57 |
| Sequences | 4 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 97.37 |
| Shannon entropy | 0.04270 |
| G+C content | 0.42544 |
| Mean single sequence MFE | -12.70 |
| Consensus MFE | -12.49 |
| Energy contribution | -12.30 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.45 |
| Structure conservation index | 0.98 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.28 |
| SVM RNA-class probability | 0.987420 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13476540 57 - 22422827 CUAUUUUGCACCAUCUAAAUCGGGGUCACAACUUUAUCUGGCCCCAACCAAUUACAU .....................(((((((..........)))))))............ ( -11.70, z-score = -2.24, R) >droEre2.scaffold_4690 5342357 57 + 18748788 CCAUUUUGCACCAUCUAAAUUGGGGCCACAACUUUAUCUGGCCCCAACCAAUUACAU ...................(((((((((..........))))))))).......... ( -15.70, z-score = -3.07, R) >droYak2.chrX 7758192 57 - 21770863 CUAUUUUGCACCAUCUAAAUCGGGGUCACAACUUUAUCUGGCCCCAACCAAUUACAU .....................(((((((..........)))))))............ ( -11.70, z-score = -2.24, R) >droSec1.super_20 108979 57 - 1148123 CUAUUUUGCACCAUCUAAAUCGGGGUCACAACUUUAUCUGGCCCCAACCAAUUACAU .....................(((((((..........)))))))............ ( -11.70, z-score = -2.24, R) >consensus CUAUUUUGCACCAUCUAAAUCGGGGUCACAACUUUAUCUGGCCCCAACCAAUUACAU .....................(((((((..........)))))))............ (-12.49 = -12.30 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:40:33 2011