| Sequence ID | dm3.chrX |
|---|---|
| Location | 13,415,803 – 13,415,899 |
| Length | 96 |
| Max. P | 0.996468 |
| Location | 13,415,803 – 13,415,899 |
|---|---|
| Length | 96 |
| Sequences | 5 |
| Columns | 117 |
| Reading direction | reverse |
| Mean pairwise identity | 79.07 |
| Shannon entropy | 0.33283 |
| G+C content | 0.41826 |
| Mean single sequence MFE | -19.08 |
| Consensus MFE | -11.98 |
| Energy contribution | -12.98 |
| Covariance contribution | 1.00 |
| Combinations/Pair | 1.11 |
| Mean z-score | -3.30 |
| Structure conservation index | 0.63 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.94 |
| SVM RNA-class probability | 0.996468 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13415803 96 - 22422827 AAAAAUCUCUCUAAUCCGUGGCAUUUAAAUCUUUGUGCGCGCUCAUGUGUAC---ACUGUCAACCAGUGAUAAAUGCCAACCCACUAAUAAAUCACCCC------------------ ..................(((((((((.......(((((((....)))))))---((((.....))))..)))))))))....................------------------ ( -21.10, z-score = -4.16, R) >droSim1.chrX 10290959 94 - 17042790 AAAAAUCCCUCUAAUCCGUGGCAUUUAAAUC--UGUGUGCGCUCAUGUGUAC---ACUGUCAACCAGUGAUAAAUGCCAACCCACUAAUAAAUCACCCC------------------ ..................(((((((((....--.((((((((....))))))---))..(((.....))))))))))))....................------------------ ( -22.60, z-score = -5.07, R) >droSec1.super_20 48578 94 - 1148123 AAAAAUCCCUCUAAUCCGUGGAAUUUAAAUC--UGUGUGCGCUCAUGUGUAC---ACUGUCAACCAGUGAUAAAUGCCAACCCCCUAAUAAAUCACCCC------------------ .................((((..........--.((((((((....))))))---))(((((.....)))))....................))))...------------------ ( -16.40, z-score = -3.25, R) >droYak2.chrX 7694900 115 - 21770863 AAAAAUCUGUGAAAUGCGUGGCAUUUAAAUC--UGAAUGUGCUCAUGUGUACACUACUGUCACCCAUUGAUAAAUGCCAAAUGCCAAAUGCCCCCGUCCCUAAUAAUAAAUCACCGC ........((((......(((((((((....--....(((((......)))))......(((.....))))))))))))...((.....))...................))))... ( -18.60, z-score = -1.06, R) >droEre2.scaffold_4690 5283834 94 + 18748788 AAAAAUCCCUCUAAUCCGCGGCAUUUAAAUC--UGUUUGUGCUCAUGCGUAC---ACUGUCAGACAUUGAUAAAUGCCAACCCUCUAAUAAAUCACCCC------------------ ...................((((((((..((--((..(((((......))))---)....))))......)))))))).....................------------------ ( -16.70, z-score = -2.99, R) >consensus AAAAAUCCCUCUAAUCCGUGGCAUUUAAAUC__UGUGUGCGCUCAUGUGUAC___ACUGUCAACCAGUGAUAAAUGCCAACCCACUAAUAAAUCACCCC__________________ ..................(((((((((.........((((((....))))))...((((.....))))..)))))))))...................................... (-11.98 = -12.98 + 1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:40:20 2011