Sequence ID | dm3.chrX |
---|---|
Location | 13,279,412 – 13,279,463 |
Length | 51 |
Max. P | 0.779059 |
Location | 13,279,412 – 13,279,463 |
---|---|
Length | 51 |
Sequences | 5 |
Columns | 51 |
Reading direction | reverse |
Mean pairwise identity | 67.65 |
Shannon entropy | 0.58299 |
G+C content | 0.42949 |
Mean single sequence MFE | -7.74 |
Consensus MFE | -5.65 |
Energy contribution | -5.69 |
Covariance contribution | 0.04 |
Combinations/Pair | 1.60 |
Mean z-score | -0.42 |
Structure conservation index | 0.73 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.66 |
SVM RNA-class probability | 0.779059 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13279412 51 - 22422827 CAUGAGAUGGUAUCUUCGUGUCAACUCUGCUUACCGUCUUAAUUUGAUCCU ..((((((((((.....((....))......)))))))))).......... ( -11.90, z-score = -2.57, R) >droSim1.chrX 10171693 51 - 17042790 CGUGAAAUGGUAUCUUCGUGUCCACUCUGCUUACCGUCUUAAUUUGAUCCU ..(((.((((((.....((....))......)))))).))).......... ( -5.40, z-score = -0.17, R) >droSec1.super_21 1032704 51 - 1102487 CGUGAAAUGGUAUCUUCGUGACCACUCUGCUUACCGUCUUAAUUUGAUCCU ..(((.((((((.....((....))......)))))).))).......... ( -5.40, z-score = 0.13, R) >droEre2.scaffold_4690 5159412 50 + 18748788 -UGGGGAUGGUCUCUCCAUGCCCACUUUGCUCACCGUCUUCAUUUGAUCCU -((((.((((.....)))).))))........................... ( -12.10, z-score = -0.87, R) >triCas2.ChLG4 7311742 51 - 13894384 CACCGGGGGGAAGUGUUACAUUCAUUUUAAUUUAAGUUUUGUUGUGGUUUU .((((.((.((((.......................)))).)).))))... ( -3.90, z-score = 1.40, R) >consensus CAUGAGAUGGUAUCUUCGUGUCCACUCUGCUUACCGUCUUAAUUUGAUCCU ..((((((((((...................)))))))))).......... ( -5.65 = -5.69 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:39:59 2011