| Sequence ID | dm3.chrX |
|---|---|
| Location | 13,168,417 – 13,168,483 |
| Length | 66 |
| Max. P | 0.903078 |
| Location | 13,168,417 – 13,168,483 |
|---|---|
| Length | 66 |
| Sequences | 6 |
| Columns | 72 |
| Reading direction | forward |
| Mean pairwise identity | 90.39 |
| Shannon entropy | 0.17572 |
| G+C content | 0.28093 |
| Mean single sequence MFE | -11.12 |
| Consensus MFE | -8.65 |
| Energy contribution | -9.18 |
| Covariance contribution | 0.53 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.33 |
| Structure conservation index | 0.78 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.17 |
| SVM RNA-class probability | 0.903078 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13168417 66 + 22422827 ------UUGUGUGUUCUUUUUAAAAAUAGAGACCGCUGAGUUUAUAAAAGAACAAAAAUAAAUUCAAACGAA ------((((.(((((((((((((..(((......)))..)))).)))))))))...))))........... ( -11.80, z-score = -2.36, R) >droSim1.chr2L 15996612 66 - 22036055 ------UUGUGUGUUCUUUUUAAAAAUAGAGCCCGCAGAGUUUAUAAAAGAACAAAAAUAAAUUCAAACGAA ------.((((.(((((..........))))).))))((((((((............))))))))....... ( -12.20, z-score = -3.01, R) >droSec1.super_21 923386 66 + 1102487 ------UUGUGUGUUCUUUUUAAAAAUAGAGCCCGCAGAGUUUAUAAAAGAACAAAAAUAAAUUCAAACGAA ------.((((.(((((..........))))).))))((((((((............))))))))....... ( -12.20, z-score = -3.01, R) >droEre2.scaffold_4690 5042762 66 - 18748788 ------UUGUGUGUUCUUUUUAAAAAUAGAGCCCGCAGAGUUUAUAAAAGAACAAAAAUAAAUUCAAAGGAA ------.((((.(((((..........))))).))))((((((((............))))))))....... ( -12.20, z-score = -2.69, R) >droYak2.chrX 7444922 66 + 21770863 ------UUGUGUGUUCCUGUUAAAAAUAGAGCCCGCAGAGUUUAUAAAAGAACCAAAAUAAAUUCAAAGGAA ------.((((.((((.(((.....))))))).))))((((((((............))))))))....... ( -11.20, z-score = -2.61, R) >droAna3.scaffold_13117 1813676 72 - 5790199 CUGUGUGUGUGAGUGAUUUUUAAAAAUAAAACCCGCCGAGUUUAUAAAAGAACAAAAAUAAAUUCAAAGGAA ......(.(((.((.((((....))))...)).))))((((((((............))))))))....... ( -7.10, z-score = -0.27, R) >consensus ______UUGUGUGUUCUUUUUAAAAAUAGAGCCCGCAGAGUUUAUAAAAGAACAAAAAUAAAUUCAAACGAA ........(((.(((((..........))))).))).((((((((............))))))))....... ( -8.65 = -9.18 + 0.53)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:39:38 2011