| Sequence ID | dm3.chrX |
|---|---|
| Location | 12,587,700 – 12,587,755 |
| Length | 55 |
| Max. P | 0.994980 |
| Location | 12,587,700 – 12,587,755 |
|---|---|
| Length | 55 |
| Sequences | 8 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 92.82 |
| Shannon entropy | 0.14922 |
| G+C content | 0.30214 |
| Mean single sequence MFE | -7.39 |
| Consensus MFE | -7.50 |
| Energy contribution | -7.75 |
| Covariance contribution | 0.25 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.35 |
| Structure conservation index | 1.02 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.75 |
| SVM RNA-class probability | 0.994980 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 12587700 55 - 22422827 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCCUACACUCGAC -.....((((((........))))))((((..(((....-...)))..))))..... ( -8.30, z-score = -2.41, R) >droSim1.chrX 9614046 55 - 17042790 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCCUACACUCUAC -.....((((((........))))))((((..(((....-...)))..))))..... ( -8.30, z-score = -2.78, R) >droSec1.super_21 342044 55 - 1102487 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCCUACACUCUAC -.....((((((........))))))((((..(((....-...)))..))))..... ( -8.30, z-score = -2.78, R) >droYak2.chrX 6864963 56 - 21770863 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAACUUUUUGCCUACACUCCGC -.....((((((........))))))((((..(((........)))..))))..... ( -8.60, z-score = -2.40, R) >droEre2.scaffold_4690 4476842 55 + 18748788 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCCUACACUCCUC -.....((((((........))))))((((..(((....-...)))..))))..... ( -8.30, z-score = -3.40, R) >droAna3.scaffold_13117 3506693 55 - 5790199 -CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCCUACACUCGGA -.....((((((........))))))((((..(((....-...)))..))))..... ( -8.30, z-score = -1.81, R) >dp4.chrXL_group1a 3385273 56 - 9151740 CCUUUAAUUAAAUCGUAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCUUACCCUCCAC ......((((((........))))))..((..(((....-...)))..))....... ( -4.50, z-score = -1.51, R) >droPer1.super_77 137425 53 + 256778 CCUUUAAUUAAAUCGUAUUUUUUAAUGUGUUUGCAUAAC-UUUUGCUUACCCUC--- ......((((((........))))))..((..(((....-...)))..))....--- ( -4.50, z-score = -1.72, R) >consensus _CUUUAAUUAAAUCGCAUUUUUUAAUGUGUUUGCAUAAC_UUUUGCCUACACUCCAC ......((((((........))))))((((..(((........)))..))))..... ( -7.50 = -7.75 + 0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:37:58 2011