| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,942,547 – 11,942,607 |
| Length | 60 |
| Max. P | 0.581245 |
| Location | 11,942,547 – 11,942,607 |
|---|---|
| Length | 60 |
| Sequences | 8 |
| Columns | 62 |
| Reading direction | reverse |
| Mean pairwise identity | 88.43 |
| Shannon entropy | 0.22590 |
| G+C content | 0.37093 |
| Mean single sequence MFE | -16.16 |
| Consensus MFE | -9.76 |
| Energy contribution | -8.50 |
| Covariance contribution | -1.26 |
| Combinations/Pair | 1.47 |
| Mean z-score | -2.31 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.18 |
| SVM RNA-class probability | 0.581245 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11942547 60 - 22422827 ACAAAC-AAUUGGCAUGUUUUUGACUUUUUGCUG-CUCGGCGACAUGUUUGUUGUUAAUUUG ...(((-(((..(((((((.(((((........)-.)))).)))))))..))))))...... ( -15.80, z-score = -2.64, R) >droMoj3.scaffold_6308 3338603 58 - 3356042 --AAAC-AAUUUGCAUGUUUUUGGCUUUUUGCAG-CUUGGCGGCAUUCAUGUUGUUAAUUUG --.(((-(((.((.(((((...((((......))-))....))))).)).))))))...... ( -12.40, z-score = -0.50, R) >droVir3.scaffold_12928 3425400 60 - 7717345 AUGAGC-AACUGGCAUGUUUUUGGCUUUUUGCAG-CUUGGCGGCGUGCAUGUUGUUAAUUUG ...(((-(((..(((((((...((((......))-))....)))))))..))))))...... ( -17.80, z-score = -1.05, R) >droAna3.scaffold_13335 1908052 62 + 3335858 ACAAACAAAUUGGCAUGUUUUUGGCUUUUUGCAGAAAUGGCGACAUGUUUGUUGUUAAUUUG ...(((((...((((((((....(((.(((....))).)))))))))))..)))))...... ( -13.10, z-score = -0.77, R) >droEre2.scaffold_4690 3865956 60 + 18748788 ACAAAC-AAUUGGCAUGUUUUUGGUUUUUUGCUG-CUCGACGACAUGUUUGUUGUUAAUUUG ...(((-(((..(((((((.(((((........)-).))).)))))))..))))))...... ( -16.60, z-score = -3.01, R) >droYak2.chrX 19863032 60 + 21770863 ACAAAC-AAUUGGCAUGUUUUUGGUUUUUUGCUG-CUCGACGACGUGUUUGUUGUUAAUUUG ...(((-(((..(((((((.(((((........)-).))).)))))))..))))))...... ( -16.20, z-score = -2.62, R) >droSec1.super_53 159010 60 - 190754 ACAAAC-AAUUGGCAUGUUUUUGGCUUUUUGCUG-CUCGACGACAUGUUUGUUGUUAAUUUG ...(((-(((..(((((((.(((((........)-).))).)))))))..))))))...... ( -18.70, z-score = -3.95, R) >droSim1.chrX 9206072 60 - 17042790 ACAAAC-AAUUGGCAUGUUUUUGGCUUUUUGCUG-CUCGACGACAUGUUUGUUGUUAAUUUG ...(((-(((..(((((((.(((((........)-).))).)))))))..))))))...... ( -18.70, z-score = -3.95, R) >consensus ACAAAC_AAUUGGCAUGUUUUUGGCUUUUUGCUG_CUCGACGACAUGUUUGUUGUUAAUUUG ...(((.(((.((((((((.(((((.....)).....))).)))))))).))))))...... ( -9.76 = -8.50 + -1.26)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:36:00 2011