| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,781,194 – 11,781,248 |
| Length | 54 |
| Max. P | 0.564927 |
| Location | 11,781,194 – 11,781,248 |
|---|---|
| Length | 54 |
| Sequences | 5 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 71.72 |
| Shannon entropy | 0.50794 |
| G+C content | 0.36481 |
| Mean single sequence MFE | -9.52 |
| Consensus MFE | -6.48 |
| Energy contribution | -6.12 |
| Covariance contribution | -0.36 |
| Combinations/Pair | 1.36 |
| Mean z-score | -0.63 |
| Structure conservation index | 0.68 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.15 |
| SVM RNA-class probability | 0.564927 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11781194 54 - 22422827 AAUUUGGUGUUGGUAAACGCAAAGCGAAU--AACCCAAUCAACAGCUGAUUGAAUA ......(((((....))))).........--....((((((.....)))))).... ( -9.40, z-score = -0.58, R) >droSim1.chrX 9081523 54 - 17042790 AAUUUGGUGUUAGUAAACGCAAAACGAAU--AACCCAAUCAACAGCUGAUUGGAUA ......(((((....))))).........--...(((((((.....)))))))... ( -11.80, z-score = -2.16, R) >droYak2.chrX 6854226 54 + 21770863 AGUGUGGUGUUGGUAAACGCAAAAUGAAU--AACCCAAUCAACAGCUGAUUGAAUA ......(((((....))))).........--....((((((.....)))))).... ( -9.40, z-score = -0.42, R) >droEre2.scaffold_4690 15330421 54 + 18748788 GAAGCGGUGUUGGUGAACGCGAAUUGAGU--AGCCCAAUCAACAGCUGAUUGGAUA ......(((((....))))).........--...(((((((.....)))))))... ( -12.00, z-score = -0.45, R) >dp4.chrXL_group1e 7999874 56 + 12523060 AGCAUAAUAUUGGCCAAAAUUAAACAAAUCAAUGUUUAUUAGCAGACAAUUGUAUA .(((....((((........((((((......))))))........)))))))... ( -4.99, z-score = 0.48, R) >consensus AAUGUGGUGUUGGUAAACGCAAAACGAAU__AACCCAAUCAACAGCUGAUUGAAUA ......(((((....)))))...............((((((.....)))))).... ( -6.48 = -6.12 + -0.36)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:35:35 2011