| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,420,456 – 11,420,519 |
| Length | 63 |
| Max. P | 0.924296 |
| Location | 11,420,456 – 11,420,519 |
|---|---|
| Length | 63 |
| Sequences | 3 |
| Columns | 63 |
| Reading direction | forward |
| Mean pairwise identity | 81.28 |
| Shannon entropy | 0.26496 |
| G+C content | 0.46342 |
| Mean single sequence MFE | -19.20 |
| Consensus MFE | -14.22 |
| Energy contribution | -15.00 |
| Covariance contribution | 0.78 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.20 |
| Structure conservation index | 0.74 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.31 |
| SVM RNA-class probability | 0.924296 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11420456 63 + 22422827 ACCAACACUCUACAUGCGUUUGUAUUUGUGUAUCGCUCGUGUGUGUGUGUGUGUGUGGAGUGU ....((((((((((((((..(..((.((.(.....).))...))..)..)))))))))))))) ( -19.40, z-score = -1.73, R) >droSim1.chrX_random 3199795 55 + 5698898 ACCAACACUCUACAUGUGUUUGUAUUUCGCUCGUGU--GUGUG------UGUGUGUGGAGUGU ....((((((((((((..(........(((....))--)...)------..)))))))))))) ( -17.30, z-score = -2.26, R) >droSec1.super_36 142043 61 + 449511 ACCAACACUCUACAUGUGUUUGUAUUUCGCUGGUGU--GUGUGCGUGUCUGUGUGUGGAGUGU ....((((((((((..((..(((((..(((....))--).)))))....))..)))))))))) ( -20.90, z-score = -2.61, R) >consensus ACCAACACUCUACAUGUGUUUGUAUUUCGCUAGUGU__GUGUG_GUGU_UGUGUGUGGAGUGU ....((((((((((..((.........(((........)))........))..)))))))))) (-14.22 = -15.00 + 0.78)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:34:29 2011