| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,412,030 – 11,412,127 |
| Length | 97 |
| Max. P | 0.837306 |
| Location | 11,412,030 – 11,412,127 |
|---|---|
| Length | 97 |
| Sequences | 3 |
| Columns | 99 |
| Reading direction | reverse |
| Mean pairwise identity | 87.80 |
| Shannon entropy | 0.17116 |
| G+C content | 0.36519 |
| Mean single sequence MFE | -23.77 |
| Consensus MFE | -21.14 |
| Energy contribution | -21.03 |
| Covariance contribution | -0.11 |
| Combinations/Pair | 1.08 |
| Mean z-score | -1.63 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.86 |
| SVM RNA-class probability | 0.837306 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11412030 97 - 22422827 AUCGAUUCGGAUUCGGAUUUGGUUUUGGAUUCGGAUCGUAUCGAAUGGCGUUGCCUUUGAUCGCAUUGUUUUUUUUUU--CUUUCUAUUUUAAAAUUGC ...((((((((((((((......))))))))))))))((((((((.(((...))))))))).))..............--................... ( -24.40, z-score = -1.90, R) >droSec1.super_36 133795 92 - 449511 AUCGAUUCGGAUUCGGAUUUGGUUUUGGAUUCGGAUCGUAUCGAAUGGCGUUGCCUUUGAUCGC-----UUUUUUUUU--CUAGCUAUUUUCAAAUUGC ..(((((((((((((((......))))))))))))))).((((((.(((...))))))))).((-----(........--..))).............. ( -24.90, z-score = -1.86, R) >droYak2.chrX 11027595 99 + 21770863 AUCGAUUCGAAUUUGGAUUUGGAUUUGGAUUCGGAUCGUAUCGAAUCGCGUUGCCUUUGAUCGCGUUUUUUUUUUUCUUACUAUUUUUUUUCAAAUUGC ..(((((((((((..(((....)))..)))))))))))....(((.((((((......)).)))).))).............................. ( -22.00, z-score = -1.13, R) >consensus AUCGAUUCGGAUUCGGAUUUGGUUUUGGAUUCGGAUCGUAUCGAAUGGCGUUGCCUUUGAUCGC_UU_UUUUUUUUUU__CUAUCUAUUUUCAAAUUGC ...((((((((((((((......))))))))))))))((((((((.(((...))))))))).))................................... (-21.14 = -21.03 + -0.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:34:28 2011