| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,344,538 – 11,344,638 |
| Length | 100 |
| Max. P | 0.998522 |
| Location | 11,344,538 – 11,344,638 |
|---|---|
| Length | 100 |
| Sequences | 4 |
| Columns | 105 |
| Reading direction | forward |
| Mean pairwise identity | 80.33 |
| Shannon entropy | 0.30089 |
| G+C content | 0.31312 |
| Mean single sequence MFE | -27.93 |
| Consensus MFE | -18.15 |
| Energy contribution | -19.90 |
| Covariance contribution | 1.75 |
| Combinations/Pair | 1.18 |
| Mean z-score | -3.80 |
| Structure conservation index | 0.65 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.39 |
| SVM RNA-class probability | 0.998522 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11344538 100 + 22422827 AAAAAAAAACAGCUGGGAUAACGCAGAGUAAUAUGGCAAAUCUAGAAAGUA-UUUUGUUAUUGUAGCUGUUUUUU----UUUCAUUUCAGUACUUAAUGAGAUGA .((((((((((((((.((((..((((((((...(((.....))).....))-)))))))))).))))))))))))----))((((((((........)))))))) ( -31.90, z-score = -5.41, R) >droEre2.scaffold_4690 14937418 92 - 18748788 ---AAAAAACAGCUGAGAUAACGCAGAGCAAAAAGGCAAUUGCAUAAAGUA-AUUUGUUGCUUUAGCAGUUUUU---------AUUUCAGUACUUAAUGCGAUGA ---........((((((((((......((......))((((((.(((((((-(....)))))))))))))).))---------)))))))).............. ( -22.90, z-score = -1.69, R) >droYak2.chrX 10962488 93 - 21770863 ---GAGAAACGGUUGAGAUAACGCAGAGUAAUAUGGCAAUGCUAGAAAGUAAUUUUGGUGUUUUAGCCGUUUUU---------AUUUCAGUACUUAACGAGAUGA ---.((((((((((((((((.(.((((((.((.((((...))))....)).)))))))))))))))))))))))---------(((((.((.....))))))).. ( -24.20, z-score = -2.98, R) >droSim1.chrX 8753364 103 + 17042790 -AAAAAAAACAGCUGAGAUAACGCAGAGUAAUAUGGCAAAUCUAGAAUGUA-UCUUGUUAUUUUAGCUGUUUUUUGUUUUUUCAUUUCAGUACUUAAUGAGAUGA -..((((((((((((((((((((.(((......(((.....))).......-)))))))))))))))))))))))......((((((((........)))))))) ( -32.72, z-score = -5.11, R) >consensus ___AAAAAACAGCUGAGAUAACGCAGAGUAAUAUGGCAAAUCUAGAAAGUA_UUUUGUUAUUUUAGCUGUUUUU_________AUUUCAGUACUUAAUGAGAUGA ....(((((((((((((((((((.(((.((...(((.....))).....)).))))))))))))))))))))))........(((((((........))))))). (-18.15 = -19.90 + 1.75)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:34:11 2011