| Sequence ID | dm3.chrX |
|---|---|
| Location | 11,183,703 – 11,183,795 |
| Length | 92 |
| Max. P | 0.983057 |
| Location | 11,183,703 – 11,183,795 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 96 |
| Reading direction | forward |
| Mean pairwise identity | 87.21 |
| Shannon entropy | 0.21090 |
| G+C content | 0.29401 |
| Mean single sequence MFE | -18.22 |
| Consensus MFE | -16.20 |
| Energy contribution | -16.24 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.35 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.12 |
| SVM RNA-class probability | 0.983057 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 11183703 92 + 22422827 AAUAUUUGCCAUGUCACAAUGUUGCAAAUACUUUUGCAGCCAGUUA----AAAUAAAAAAAAAAAAACGGACAAAUAAUACGUAGUAACAAAAAAU ..((((((((..........((((((((....))))))))..(((.----...............))))).))))))................... ( -14.49, z-score = -1.76, R) >droEre2.scaffold_4690 14784321 81 - 18748788 AAUAUUUGCCAUGUCACAAUGUUGCAAAUACUUUUGCAGCCAGCUA---------------AAAAAAAGGGCAAAUAGUACGUAGUAACAAAAAAU ..((((((((..........((((((((....))))))))...((.---------------......))))))))))................... ( -17.70, z-score = -1.90, R) >droYak2.chrX 10810807 82 - 21770863 AAUAUUUGCCAUGUCACAAUGCUGCAAAUACUUUUGCAGCCAGUUA--------------AAAAAAAAGGGCAAAUAAUACGUAGUAACAAAAAAU ..((((((((((......))((((((((....))))))))......--------------.........))))))))................... ( -19.50, z-score = -2.88, R) >droSec1.super_15 1868776 96 + 1954846 AAUAUUUGCCAUGUCACAAUGUUGCAAAUACUUUUGCAGCCAGUUACAAAAAACAAAAACAAAAAAACGGGCAAAUAAUAGGUAGUAACAAAAAAU ..((((((((.(((......((((((((....))))))))..(((......)))............)))))))))))................... ( -19.70, z-score = -2.61, R) >droSim1.chrU 4055763 96 - 15797150 AAUAUUUGCCAUGUCACAAUGUUGCAAAUACUUUUGCAGCCAGUUACAAAAAACAAAAACAAAAAAACGGGCAAAUAAUAGGUAGUAACAAAAAAU ..((((((((.(((......((((((((....))))))))..(((......)))............)))))))))))................... ( -19.70, z-score = -2.61, R) >consensus AAUAUUUGCCAUGUCACAAUGUUGCAAAUACUUUUGCAGCCAGUUA____AAA_AAAAA_AAAAAAACGGGCAAAUAAUACGUAGUAACAAAAAAU ..((((((((((......))((((((((....)))))))).............................))))))))................... (-16.20 = -16.24 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:33:49 2011