| Sequence ID | dm3.chrX |
|---|---|
| Location | 10,872,569 – 10,872,629 |
| Length | 60 |
| Max. P | 0.517212 |
| Location | 10,872,569 – 10,872,629 |
|---|---|
| Length | 60 |
| Sequences | 3 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 91.06 |
| Shannon entropy | 0.12244 |
| G+C content | 0.31460 |
| Mean single sequence MFE | -6.57 |
| Consensus MFE | -5.73 |
| Energy contribution | -5.73 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.43 |
| Structure conservation index | 0.87 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.05 |
| SVM RNA-class probability | 0.517212 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 10872569 60 + 22422827 GUUAUGCGCUUUAAAAUCAUAUAUAUAUAUAUAAUUCCUUUUCUCGCAGUGCACUGCUCU ((..((((((..((((...(((((....))))).....)))).....))))))..))... ( -6.10, z-score = -0.20, R) >droSec1.super_15 1574579 59 + 1954846 GUUAUUCGUUUUAAAAUCAUAUAAAUAUAAAUA-UCCCUUUUCUCGCAGUGCACUGCGCU .................................-..........(((((....))))).. ( -6.80, z-score = -1.46, R) >droSim1.chrX 8425741 59 + 17042790 GUUAUUCGUUUUAAAAUCAUAUAAAUAUAAAUA-UCCCUUUUCUCGCAGUUCACUGCGCU .................................-..........(((((....))))).. ( -6.80, z-score = -2.63, R) >consensus GUUAUUCGUUUUAAAAUCAUAUAAAUAUAAAUA_UCCCUUUUCUCGCAGUGCACUGCGCU .............................................((((....))))... ( -5.73 = -5.73 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:32:45 2011