| Sequence ID | dm3.chrX |
|---|---|
| Location | 10,657,571 – 10,657,626 |
| Length | 55 |
| Max. P | 0.647223 |
| Location | 10,657,571 – 10,657,626 |
|---|---|
| Length | 55 |
| Sequences | 6 |
| Columns | 55 |
| Reading direction | forward |
| Mean pairwise identity | 52.80 |
| Shannon entropy | 0.87415 |
| G+C content | 0.36393 |
| Mean single sequence MFE | -9.75 |
| Consensus MFE | -3.99 |
| Energy contribution | -3.42 |
| Covariance contribution | -0.58 |
| Combinations/Pair | 1.82 |
| Mean z-score | -0.48 |
| Structure conservation index | 0.41 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.33 |
| SVM RNA-class probability | 0.647223 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 10657571 55 + 22422827 ACAAAAACAAGCUGAGUGGACAAUAACACGACUGCUGUCGUUGCUGUUGUUGUUA ..................((((((((((((((....)))))....))))))))). ( -14.10, z-score = -0.96, R) >droSec1.super_15 1355716 55 + 1954846 ACAAAAACAAGCUGAGUGGACAAUAACACGACUGCUGUCGUUGCUGUUGUUGUUA ..................((((((((((((((....)))))....))))))))). ( -14.10, z-score = -0.96, R) >dp4.chrXR_group6 3497294 50 - 13314419 -----AAAGAAUUUCGUCAAUUGUACAGUGAAACCUCUAACAGAUAUAAUGAUCA -----..........((((.((((((.((..........)).).))))))))).. ( -2.10, z-score = 1.41, R) >droPer1.super_61 256972 50 - 350175 -----AAAGAAUUUCGUCAAUUGUACAGUGAAACCUCUAACAGAUAUAAUGAUCA -----..........((((.((((((.((..........)).).))))))))).. ( -2.10, z-score = 1.41, R) >droWil1.scaffold_181096 6414534 52 - 12416693 ACAACAACAAGACAAAACAACAAAAAAGCAACCUCUGUUGCUGUUGUUGUUG--- ...............((((((((...((((((....)))))).)))))))).--- ( -15.80, z-score = -3.24, R) >droGri2.scaffold_15203 8478656 55 - 11997470 AAAAAAAAAAGAAGAGAAAAAAUGCAAGCGGCUGCUAGUGCUGCUGUUGUUGUUG .......................(((((((((.((....)).)))))..)))).. ( -10.30, z-score = -0.53, R) >consensus ACAAAAAAAAGAUGAGUCAACAAUAAAGCGACUGCUGUAGCUGCUGUUGUUGUUA ..................(((((((..((((......))))...))))))).... ( -3.99 = -3.42 + -0.58)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:32:10 2011