| Sequence ID | dm3.chr2L |
|---|---|
| Location | 10,866,768 – 10,866,821 |
| Length | 53 |
| Max. P | 0.505290 |
| Location | 10,866,768 – 10,866,821 |
|---|---|
| Length | 53 |
| Sequences | 3 |
| Columns | 53 |
| Reading direction | forward |
| Mean pairwise identity | 92.31 |
| Shannon entropy | 0.10396 |
| G+C content | 0.61459 |
| Mean single sequence MFE | -14.60 |
| Consensus MFE | -13.59 |
| Energy contribution | -13.37 |
| Covariance contribution | -0.22 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.10 |
| Structure conservation index | 0.93 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.02 |
| SVM RNA-class probability | 0.505290 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 10866768 53 + 23011544 AAGUGGUCAUCACUGAUUGUGGGCGUUCGCAUUGGUGGGCGGGGCAGCAGGUC ..((.(((.((((.....)))).(((((((....))))))).))).))..... ( -15.30, z-score = -0.99, R) >droSim1.chr2L 10673107 50 + 22036055 AAGUGGUCAUCACUG---GUGGGCGUUCGCAUUGGUGGGCGGGGCUGUAGGUC ..(..(((.((((..---(((.(....).)))..))))....)))..)..... ( -15.20, z-score = -1.58, R) >droSec1.super_3 6283030 50 + 7220098 AUGUGGUCAUCACUG---GUGGGCGUUCGCAUUGGUGGGCGGGGCAGUAGGUC .....(((.((((..---(((.(....).)))..))))....)))........ ( -13.30, z-score = -0.74, R) >consensus AAGUGGUCAUCACUG___GUGGGCGUUCGCAUUGGUGGGCGGGGCAGUAGGUC ..(..(((.((((.....)))).(((((((....))))))).)))..)..... (-13.59 = -13.37 + -0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:31:08 2011