| Sequence ID | dm3.chrX |
|---|---|
| Location | 10,317,467 – 10,317,559 |
| Length | 92 |
| Max. P | 0.659218 |
| Location | 10,317,467 – 10,317,559 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 118 |
| Reading direction | forward |
| Mean pairwise identity | 48.96 |
| Shannon entropy | 0.80421 |
| G+C content | 0.62909 |
| Mean single sequence MFE | -31.02 |
| Consensus MFE | -8.00 |
| Energy contribution | -10.20 |
| Covariance contribution | 2.20 |
| Combinations/Pair | 1.37 |
| Mean z-score | -1.56 |
| Structure conservation index | 0.26 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.36 |
| SVM RNA-class probability | 0.659218 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 10317467 92 + 22422827 ------------UGUCCCAGCCAA---CGCAAAGCCCCCGUUUCUGCCCAAGAUGUCCUGCGUCCUGUGGC-CUACGUCCUGUGUCCUGCGUGGG----UUGCCUGGAGCAA------ ------------((..((((.(((---(.................(((((.((((.....)))).)).)))-((((((..........)))))))----))).))))..)).------ ( -28.90, z-score = -1.33, R) >droSim1.chrX_random 2916307 78 + 5698898 ------------UGUCCCGGCCAC---CCCAAGGCCCCCGUUUCUGCCCAGGAUGUCCUGCGUCCUGUG---------------UCCUGCGUGGG----UUGCCCGGGGCAA------ ------------((((((((.((.---......((((.(((....((.(((((((.....))))))).)---------------)...))).)))----))).)))))))).------ ( -36.21, z-score = -2.60, R) >droSec1.super_15 1012247 78 + 1954846 ------------UGUCCCGGCCAC---CCCAAGGCCCCCGUUUCUGCCCAGGAUGUCCUGCGUCCUGUG---------------UCCUGCGUGGG----UUGCCCGGGGCAA------ ------------((((((((.((.---......((((.(((....((.(((((((.....))))))).)---------------)...))).)))----))).)))))))).------ ( -36.21, z-score = -2.60, R) >droAna3.scaffold_13335 926748 109 - 3335858 CUUCCACUUCAUCCUCUCAUCCAC---CCUCCUCUUCCACACUCUGUGUGACCUUCUCUGCCCCUCCUAUCUCCACCUGGAAUGUCCUGGCUGAGAGAGUUGCCUUUGGCAA------ .............((((((.(((.---..........(((((...))))).....................(((....)))......))).))))))..(((((...)))))------ ( -22.60, z-score = -1.46, R) >dp4.chrXL_group1e 5650098 100 + 12523060 ------------UGUACAAACCAAUGGCCAGUUGGCCACCGCAUCGCUUUGGACAUCUGGUCUCCGCCGCCUUCGUGCUCAGCUCCGUGCUCCAG------GCCUACGGAAAGGCGAA ------------............(((((....))))).....(((((((.(((.....)))((((..((((..(..(........)..)...))------))...))))))))))). ( -31.20, z-score = 0.19, R) >consensus ____________UGUCCCAGCCAC___CCCAAGGCCCCCGUUUCUGCCCAGGAUGUCCUGCGUCCUGUG_C_____________UCCUGCGUGGG____UUGCCUGGGGCAA______ ............((((((((.(..........................(((((((.....))))))).................(((.....)))......).))))))))....... ( -8.00 = -10.20 + 2.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:31:09 2011