Sequence ID | dm3.chr2L |
---|---|
Location | 10,814,418 – 10,814,470 |
Length | 52 |
Max. P | 0.799290 |
Location | 10,814,418 – 10,814,470 |
---|---|
Length | 52 |
Sequences | 8 |
Columns | 52 |
Reading direction | forward |
Mean pairwise identity | 91.30 |
Shannon entropy | 0.15948 |
G+C content | 0.35942 |
Mean single sequence MFE | -10.86 |
Consensus MFE | -8.52 |
Energy contribution | -8.53 |
Covariance contribution | 0.00 |
Combinations/Pair | 1.00 |
Mean z-score | -2.14 |
Structure conservation index | 0.78 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.73 |
SVM RNA-class probability | 0.799290 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 10814418 52 + 23011544 CACACAUUUCACUGCACACACUUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU .......((((.(((.(.(((....))).).))))))).............. ( -9.20, z-score = -2.38, R) >droSim1.chr2L 10621200 52 + 22036055 CACGCAUUUCGCUGCACACACUUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ..........((((((((......))))).)))(((((......)))))... ( -12.50, z-score = -2.45, R) >droSec1.super_3 6232685 52 + 7220098 CACGCAUUUCGCUGCACACACUUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ..........((((((((......))))).)))(((((......)))))... ( -12.50, z-score = -2.45, R) >droYak2.chr2L 7221500 50 + 22324452 CACGCAUUUCACUGCACAC--UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ............((((((.--...))))))...(((((......)))))... ( -8.30, z-score = -1.18, R) >droEre2.scaffold_4929 12025203 50 - 26641161 CACGCAUUUCACUGCACAC--UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ............((((((.--...))))))...(((((......)))))... ( -8.30, z-score = -1.18, R) >droAna3.scaffold_12916 14665792 50 + 16180835 UAGGCAUUACGCUGCACAC--UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ..........((((((((.--...))))).)))(((((......)))))... ( -12.30, z-score = -2.27, R) >dp4.chr4_group4 3018678 50 + 6586962 CACACAUUAUGUUGCACAC--UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUC ......((((((((((((.--...))))).)))))))............... ( -11.90, z-score = -2.58, R) >droPer1.super_10 2033327 50 + 3432795 CACACAUUAUGUUGCACAC--UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUC ......((((((((((((.--...))))).)))))))............... ( -11.90, z-score = -2.58, R) >consensus CACGCAUUUCGCUGCACAC__UUUUGUGCGAGCAUGAAUAUAAUUUCAUUUU ............((((((......))))))...(((((......)))))... ( -8.52 = -8.53 + 0.00)
Location | 10,814,418 – 10,814,470 |
---|---|
Length | 52 |
Sequences | 8 |
Columns | 52 |
Reading direction | reverse |
Mean pairwise identity | 91.30 |
Shannon entropy | 0.15948 |
G+C content | 0.35942 |
Mean single sequence MFE | -11.26 |
Consensus MFE | -9.88 |
Energy contribution | -9.90 |
Covariance contribution | 0.02 |
Combinations/Pair | 1.08 |
Mean z-score | -1.33 |
Structure conservation index | 0.88 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.18 |
SVM RNA-class probability | 0.580725 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 10814418 52 - 23011544 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAAGUGUGUGCAGUGAAAUGUGUG ..........(((((((((((.(((((....))))).))).)).)))))).. ( -13.60, z-score = -2.51, R) >droSim1.chr2L 10621200 52 - 22036055 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAAGUGUGUGCAGCGAAAUGCGUG ...(((((......)))))(((((((((....)))))).))).......... ( -12.70, z-score = -1.38, R) >droSec1.super_3 6232685 52 - 7220098 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAAGUGUGUGCAGCGAAAUGCGUG ...(((((......)))))(((((((((....)))))).))).......... ( -12.70, z-score = -1.38, R) >droYak2.chr2L 7221500 50 - 22324452 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAA--GUGUGCAGUGAAAUGCGUG ...(((((......)))))(((.(((((...--.)))))))).......... ( -9.70, z-score = -0.67, R) >droEre2.scaffold_4929 12025203 50 + 26641161 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAA--GUGUGCAGUGAAAUGCGUG ...(((((......)))))(((.(((((...--.)))))))).......... ( -9.70, z-score = -0.67, R) >droAna3.scaffold_12916 14665792 50 - 16180835 AAAAUGAAAUUAUAUUCAUGCUCGCACAAAA--GUGUGCAGCGUAAUGCCUA ...(((((......)))))(((.(((((...--.)))))))).......... ( -11.90, z-score = -1.98, R) >dp4.chr4_group4 3018678 50 - 6586962 GAAAUGAAAUUAUAUUCAUGCUCGCACAAAA--GUGUGCAACAUAAUGUGUG ((.(((((......)))))..))(((((...--.)))))............. ( -9.90, z-score = -1.02, R) >droPer1.super_10 2033327 50 - 3432795 GAAAUGAAAUUAUAUUCAUGCUCGCACAAAA--GUGUGCAACAUAAUGUGUG ((.(((((......)))))..))(((((...--.)))))............. ( -9.90, z-score = -1.02, R) >consensus AAAAUGAAAUUAUAUUCAUGCUCGCACAAAA__GUGUGCAGCGAAAUGCGUG ...(((((......)))))(((.(((((......)))))))).......... ( -9.88 = -9.90 + 0.02)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:31:05 2011