| Sequence ID | dm3.chrX |
|---|---|
| Location | 10,064,974 – 10,065,026 |
| Length | 52 |
| Max. P | 0.992402 |
| Location | 10,064,974 – 10,065,026 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 52 |
| Reading direction | forward |
| Mean pairwise identity | 93.72 |
| Shannon entropy | 0.12407 |
| G+C content | 0.33654 |
| Mean single sequence MFE | -6.77 |
| Consensus MFE | -6.77 |
| Energy contribution | -6.77 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.32 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.54 |
| SVM RNA-class probability | 0.992402 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 10064974 52 + 22422827 CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCACACGCCCA ..(((((((((..................))))))))).............. ( -6.77, z-score = -2.29, R) >droSim1.chrX_random 450288 52 + 5698898 AAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCACACGCCCA ..(((((((((..................))))))))).............. ( -6.77, z-score = -2.20, R) >droSec1.super_15 776188 52 + 1954846 CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCAUACGCCCA ..(((((((((..................))))))))).............. ( -6.77, z-score = -2.13, R) >droYak2.chrX 18639918 52 + 21770863 CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUAACACGGCCC ..(((((((((..................))))))))).............. ( -6.77, z-score = -1.42, R) >droEre2.scaffold_4690 13691299 52 - 18748788 CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCACAAGCCCA ..(((((((((..................))))))))).............. ( -6.77, z-score = -2.06, R) >droAna3.scaffold_13047 874872 52 + 1816235 CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCCCACACACG ..(((((((((..................))))))))).............. ( -6.77, z-score = -3.82, R) >consensus CAGCAAUAAAAAUUUUACAGACAAUUCGCUUUUAUUGCAUUUCACACGCCCA ..(((((((((..................))))))))).............. ( -6.77 = -6.77 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:30:25 2011