| Sequence ID | dm3.chrX |
|---|---|
| Location | 9,710,762 – 9,710,816 |
| Length | 54 |
| Max. P | 0.781859 |
| Location | 9,710,762 – 9,710,816 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 91.98 |
| Shannon entropy | 0.11438 |
| G+C content | 0.56609 |
| Mean single sequence MFE | -16.90 |
| Consensus MFE | -15.98 |
| Energy contribution | -16.20 |
| Covariance contribution | 0.22 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.32 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.67 |
| SVM RNA-class probability | 0.781859 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 9710762 54 - 22422827 GGGUUUGGCAACGGGGUUCAACAGUUCAGCAGUUGGCCAUGGUUAAGUGCUGGA (..((((....).)))..).....(((((((.(((((....))))).))))))) ( -17.50, z-score = -1.87, R) >droEre2.scaffold_4690 13340197 54 + 18748788 GGGGCUGGCGACGGGGUUCAACAGUUCAGCAGUUGGCCAUGGUUAAGUGCUGGA .((((((..((......))..))))))((((.(((((....))))).))))... ( -18.20, z-score = -1.28, R) >droSim1.chrX 7741869 51 - 17042790 ---GGUGGCGACGGGGUUCAACAGUUCAGCAGUUGGCCAUGGUUAAGUGCUGGA ---..((....))...........(((((((.(((((....))))).))))))) ( -15.00, z-score = -0.82, R) >consensus GGGGCUGGCGACGGGGUUCAACAGUUCAGCAGUUGGCCAUGGUUAAGUGCUGGA ....(((....)))..........(((((((.(((((....))))).))))))) (-15.98 = -16.20 + 0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:29:32 2011