| Sequence ID | dm3.chr2L |
|---|---|
| Location | 10,754,352 – 10,754,407 |
| Length | 55 |
| Max. P | 0.809621 |
| Location | 10,754,352 – 10,754,407 |
|---|---|
| Length | 55 |
| Sequences | 9 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 79.65 |
| Shannon entropy | 0.41581 |
| G+C content | 0.35346 |
| Mean single sequence MFE | -10.76 |
| Consensus MFE | -7.31 |
| Energy contribution | -7.18 |
| Covariance contribution | -0.13 |
| Combinations/Pair | 1.46 |
| Mean z-score | -1.40 |
| Structure conservation index | 0.68 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.76 |
| SVM RNA-class probability | 0.809621 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 10754352 55 + 23011544 GAGGAAAAGCGAGUCUGC---GAUUGAUAAAAAGUCAAUUAAACUGAAUUGCAUUCUU---- .(((((..((((.((...---(((((((.....))))))).....)).)))).)))))---- ( -10.30, z-score = -1.11, R) >droSim1.chr2L 10553682 55 + 22036055 GAGGAAAAGCGAGUCUGC---GAUUGAUAAAAAGUCAAUUAAACUGAAUUGCAUUCUU---- .(((((..((((.((...---(((((((.....))))))).....)).)))).)))))---- ( -10.30, z-score = -1.11, R) >droSec1.super_3 6172710 55 + 7220098 GAGGAAAAGUGAGUCUGC---GAUUGAUAAAAAGUCAAUUAAAUUGAAUUGCAUUCUU---- .(((((..(..(.((...---(((((((.....))))))).....)).)..).)))))---- ( -8.10, z-score = -0.46, R) >droYak2.chr2L 7159134 55 + 22324452 GAGGAAAAGCGAGUCUGC---GAUUGAUAAAAAGUCAAUUAAGGUGGAUUGCAUUCUU---- .(((((..((.((((..(---(((((((.....)))))))...)..)))))).)))))---- ( -13.60, z-score = -2.33, R) >droEre2.scaffold_4929 11964170 54 - 26641161 -GAGAAAAGCGAGUCUGC---GAUUGAUAAAAACUCAAUUAGGCCGGAUUGCAUUCUU---- -(((((..((((..(.((---((((((.......))))))..)).)..)))).)))))---- ( -11.10, z-score = -0.76, R) >droAna3.scaffold_12916 14604847 62 + 16180835 GCGGAAGAGCGAGUCUGCUCCGAUUGAUAAAAAGUCAAUUAAACUGAAUUACAUUCCAAUGU ..(((((((((....))))).(((((((.....))))))).............))))..... ( -14.40, z-score = -2.29, R) >droPer1.super_10 1972988 57 + 3432795 AUCGCAAAGCGAGUCUGC---GACUGAUAAAAAGUCAAUUAAACAGAAUUACACACUCGU-- ........((((((.((.---((((.......))))((((......)))).)).))))))-- ( -10.90, z-score = -1.48, R) >droWil1.scaffold_180703 279083 55 - 3946847 GAAAAAAAGUGAGUCUGC---GUUUGAUAAAAAGUCAAUUAAAGUGAAUCACUUUUAU---- ....((((((((..((..---..(((((.....)))))....))....))))))))..---- ( -12.00, z-score = -3.31, R) >droMoj3.scaffold_6500 13461799 52 - 32352404 ---AAAAAGUGAGUCUGC---GAUUGAUAAAAAGUCGAUUAAAUCGAGUUGUGUUCGU---- ---.............((---((........((.(((((...))))).))....))))---- ( -6.10, z-score = 0.25, R) >consensus GAGGAAAAGCGAGUCUGC___GAUUGAUAAAAAGUCAAUUAAACUGAAUUGCAUUCUU____ ........((((.((......(((((((.....))))))).....)).)))).......... ( -7.31 = -7.18 + -0.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:30:53 2011