| Sequence ID | dm3.chrX |
|---|---|
| Location | 9,341,966 – 9,342,062 |
| Length | 96 |
| Max. P | 0.994192 |
| Location | 9,341,966 – 9,342,062 |
|---|---|
| Length | 96 |
| Sequences | 4 |
| Columns | 98 |
| Reading direction | reverse |
| Mean pairwise identity | 58.45 |
| Shannon entropy | 0.64101 |
| G+C content | 0.44215 |
| Mean single sequence MFE | -26.90 |
| Consensus MFE | -19.96 |
| Energy contribution | -20.28 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.63 |
| Mean z-score | -1.35 |
| Structure conservation index | 0.74 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.68 |
| SVM RNA-class probability | 0.994192 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 9341966 96 - 22422827 UACAUACAUACAUCUGCACAUAUGUGCACAUGCGACUGCAUGUGUGUGUGUGUGUGGCUCAAAGGAGUCAAUGAUC--GGUGGUCAUUCAACUUUGGG (((((((((((((..((((....))))((((((....))))))))))))))))))).(((((((...(.((((((.--....)))))).).))))))) ( -39.00, z-score = -3.20, R) >droEre2.scaffold_4690 12975735 79 + 18748788 ------CAUACACCUACACAC-----UAUACA------UAUGUAUGCACUUAUGUGGCCGAAAGGAGUCAACGAUC--GGUGGUCAUUCAACUUUGGG ------....((((.......-----..((((------((.((....)).)))))).((....))...........--))))................ ( -14.60, z-score = 0.48, R) >droSec1.super_15 110300 91 - 1954846 --CACAUAUACAUCUGCACAUAUGUGUGUACA-----CUGUACAUGUCUGUGUGUGGCUCAAAGGAGUCAAUGAUCGGGGUGGUCAUUCAACUUUGGG --...........(..((((((.(..(((((.-----..)))))..).))))))..)(((((((...(.(((((((.....))))))).).))))))) ( -28.00, z-score = -1.29, R) >droMoj3.scaffold_6473 16903852 84 + 16943266 ------UGCAGGCUUAUGCGUGCAUGUGCAUG------CAUGUGUAUGUAUGUGUGCAUAAAAGAAGUGCAGAAUG--AUUAGAGUAUCAGCUUAGAG ------...(((((.((((..(((((((((((------(....))))))))))))((((.......))))......--......)))).))))).... ( -26.00, z-score = -1.40, R) >consensus ______CAUACACCUACACAUAUGUGUACACA______CAUGUAUGUGUGUGUGUGGCUCAAAGGAGUCAAUGAUC__GGUGGUCAUUCAACUUUGGG .............(((((((((((..((((((......))))))..)))))))))))(((((((.....((((((.......))))))...))))))) (-19.96 = -20.28 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:28:16 2011