| Sequence ID | dm3.chrX |
|---|---|
| Location | 8,698,058 – 8,698,108 |
| Length | 50 |
| Max. P | 0.987933 |
| Location | 8,698,058 – 8,698,108 |
|---|---|
| Length | 50 |
| Sequences | 4 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 79.10 |
| Shannon entropy | 0.34920 |
| G+C content | 0.39518 |
| Mean single sequence MFE | -13.12 |
| Consensus MFE | -9.48 |
| Energy contribution | -10.35 |
| Covariance contribution | 0.87 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.45 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.50 |
| SVM RNA-class probability | 0.719622 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 8698058 50 + 22422827 ---------AGAAGAAGAAGCUGAAAAACUUUGACAACUGCGCAAAAGUUUUUCAGUCC ---------..........(((((((((((((..(......)..))))))))))))).. ( -14.00, z-score = -2.40, R) >droAna3.scaffold_13047 549099 57 + 1816235 AGCAAAGGAAGAAGGACGAGCC--AAAACUUUGACAACUGCGCAAAACUUUUUUGAGCA .((((((......((.....))--....))))).)....((.((((.....)))).)). ( -7.90, z-score = 0.82, R) >droSec1.super_34 71710 59 + 457129 AGAAGAAGAAGAAGAAGAGGCUGAAAAACUUUGACAACUGCGCAAAAGUUUUUCAGUCC ..................((((((((((((((..(......)..)))))))))))))). ( -16.60, z-score = -2.69, R) >droSim1.chrX 6915842 59 + 17042790 AGAAGAAGAAGAAGAAGCAGCUGAAAAACUUUGACAACUGCGCAAAAGUUUUUCAGUCC ...................(((((((((((((..(......)..))))))))))))).. ( -14.00, z-score = -1.53, R) >consensus AGAAGAAGAAGAAGAAGAAGCUGAAAAACUUUGACAACUGCGCAAAAGUUUUUCAGUCC ...................(((((((((((((..(......)..))))))))))))).. ( -9.48 = -10.35 + 0.87)
| Location | 8,698,058 – 8,698,108 |
|---|---|
| Length | 50 |
| Sequences | 4 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 79.10 |
| Shannon entropy | 0.34920 |
| G+C content | 0.39518 |
| Mean single sequence MFE | -13.75 |
| Consensus MFE | -11.59 |
| Energy contribution | -11.90 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.18 |
| Mean z-score | -2.19 |
| Structure conservation index | 0.84 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.30 |
| SVM RNA-class probability | 0.987933 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 8698058 50 - 22422827 GGACUGAAAAACUUUUGCGCAGUUGUCAAAGUUUUUCAGCUUCUUCUUCU--------- (((((((((((((((.(((....))).)))))))))))).))).......--------- ( -15.50, z-score = -3.15, R) >droAna3.scaffold_13047 549099 57 - 1816235 UGCUCAAAAAAGUUUUGCGCAGUUGUCAAAGUUUU--GGCUCGUCCUUCUUCCUUUGCU (((.((((.....)))).)))...(((((....))--)))................... ( -7.30, z-score = 0.72, R) >droSec1.super_34 71710 59 - 457129 GGACUGAAAAACUUUUGCGCAGUUGUCAAAGUUUUUCAGCCUCUUCUUCUUCUUCUUCU ((.((((((((((((.(((....))).)))))))))))))).................. ( -17.20, z-score = -3.98, R) >droSim1.chrX 6915842 59 - 17042790 GGACUGAAAAACUUUUGCGCAGUUGUCAAAGUUUUUCAGCUGCUUCUUCUUCUUCUUCU ((.((((((((((((.(((....))).)))))))))))))).................. ( -15.00, z-score = -2.34, R) >consensus GGACUGAAAAACUUUUGCGCAGUUGUCAAAGUUUUUCAGCUUCUUCUUCUUCUUCUUCU ((.((((((((((((.(((....))).)))))))))))))).................. (-11.59 = -11.90 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:26:36 2011