| Sequence ID | dm3.chrX |
|---|---|
| Location | 8,307,643 – 8,307,744 |
| Length | 101 |
| Max. P | 0.524585 |
| Location | 8,307,643 – 8,307,744 |
|---|---|
| Length | 101 |
| Sequences | 5 |
| Columns | 106 |
| Reading direction | forward |
| Mean pairwise identity | 86.72 |
| Shannon entropy | 0.21939 |
| G+C content | 0.34437 |
| Mean single sequence MFE | -24.78 |
| Consensus MFE | -19.10 |
| Energy contribution | -19.10 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.14 |
| Mean z-score | -1.59 |
| Structure conservation index | 0.77 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.06 |
| SVM RNA-class probability | 0.524585 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 8307643 101 + 22422827 -----UGUUGUGCUCACUUUGCUUGUGUUUGUUGGUUUCUGCUGGAAAACGAGCAUAAGCAGUUAAUAAUUGGCAGUGAUUGCAAUAAAUGCAAAUAUGUAUUCUU -----((((((..(((((.((((((((((((((..((((....))))))))))))))))))((((.....)))))))))..))))))((((((....))))))... ( -31.90, z-score = -3.19, R) >droEre2.scaffold_4690 11948124 93 - 18748788 -----UGUUGUGCUCACUUUGCUUUUAUUU---GGUUUCUGCUGGAAAACGGGCAUAAACAUUUAAUAAUUGGCUGUGAUUGCAAUAAAUGCAAAUAUUUU----- -----((((((..((((...(((.(((((.---.((((.((((.(....).)))).))))....)))))..))).))))..))))))..............----- ( -23.20, z-score = -2.46, R) >droYak2.chrX 8764059 99 - 21770863 UGUUGUGUUGUGUUCACUUUGCUUUUGUUU---GGUUUUUGCUGGAAAACGGGCAUAAACAGUUAAUAAUUGGCUAUGAUUGCAAUAAAUGCAAAUAUUCUU---- (((..((((((..(((....(((.(((((.---.((((.((((.(....).)))).))))....)))))..)))..)))..))))))...))).........---- ( -22.20, z-score = -1.19, R) >droSec1.super_35 157860 94 + 471130 -----UGUUGUGCUCAGUUUGCUUUUGUUU---GGUUUCUGCUGGAAAACGAGCAUAAGCAGUUAAUAAUUGGCAGUGAUUGCAAUAAAUGCAAAUGUUCUU---- -----.....(((.((((((((((.(((((---(.((((.....)))).)))))).)))))......))))))))....(((((.....)))))........---- ( -23.10, z-score = -0.55, R) >droSim1.chrX 6613564 95 + 17042790 -----UGUUGUGCUCAGUUUGCUUUUGUUU---GGUUUCUGCUGGAAAACGAGCAUAAGCAGUUA-UAAUUGGCAGUGAUUGCAAUAAAUGCAAAUGUUUCUUU-- -----.....(((.((((((((((.(((((---(.((((.....)))).)))))).)))))....-.))))))))....(((((.....)))))..........-- ( -23.50, z-score = -0.58, R) >consensus _____UGUUGUGCUCACUUUGCUUUUGUUU___GGUUUCUGCUGGAAAACGAGCAUAAGCAGUUAAUAAUUGGCAGUGAUUGCAAUAAAUGCAAAUAUUUUU____ .....((((((..(((..(((((.(((((.....((((.((((.(....).)))).))))....)))))..))))))))..))))))................... (-19.10 = -19.10 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:25:47 2011