| Sequence ID | dm3.chrX |
|---|---|
| Location | 7,323,457 – 7,323,549 |
| Length | 92 |
| Max. P | 0.681814 |
| Location | 7,323,457 – 7,323,549 |
|---|---|
| Length | 92 |
| Sequences | 8 |
| Columns | 93 |
| Reading direction | forward |
| Mean pairwise identity | 89.00 |
| Shannon entropy | 0.22433 |
| G+C content | 0.42094 |
| Mean single sequence MFE | -23.86 |
| Consensus MFE | -20.56 |
| Energy contribution | -20.83 |
| Covariance contribution | 0.27 |
| Combinations/Pair | 1.08 |
| Mean z-score | -1.35 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.40 |
| SVM RNA-class probability | 0.681814 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 7323457 92 + 22422827 UGCCUGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUCGUUGUUUCUC- .(((...(((((((.((...)).))))))).)))((((.(((((((..(((....)))...))))))).))))...................- ( -23.50, z-score = -1.27, R) >droSim1.chrX 5850645 92 + 17042790 UGCCUGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUCGUUGUUUCUC- .(((...(((((((.((...)).))))))).)))((((.(((((((..(((....)))...))))))).))))...................- ( -23.50, z-score = -1.27, R) >droSec1.super_24 532682 92 + 912625 UGCCUGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUCGUUGUUUCUC- .(((...(((((((.((...)).))))))).)))((((.(((((((..(((....)))...))))))).))))...................- ( -23.50, z-score = -1.27, R) >droYak2.chrX 7749737 78 - 21770863 UGCCAGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGU--------------- .((((((((((((....)))).....))))))))((((.(((((((..(((....)))...))))))).)))).....--------------- ( -25.10, z-score = -2.74, R) >droEre2.scaffold_4690 16234458 93 + 18748788 UGCCUGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUCGUUGUUUCGCC .(((...(((((((.((...)).))))))).)))((((.(((((((..(((....)))...))))))).)))).................... ( -23.50, z-score = -0.78, R) >dp4.chrXL_group1e 11301637 90 + 12523060 UGGCUCUAUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUUGUUUCUGC--- .((((((((((((....))))).(((((....)))))(.(((((((..(((....)))...))))))).)..)))))))...........--- ( -24.10, z-score = -1.00, R) >droPer1.super_14 744521 90 + 2168203 UGGCUCUAUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUUGUUUCUGC--- .((((((((((((....))))).(((((....)))))(.(((((((..(((....)))...))))))).)..)))))))...........--- ( -24.10, z-score = -1.00, R) >droWil1.scaffold_180777 1291837 83 - 4753960 UGUGUAUUUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUGGAGCAGUUG---------- .((((((((((((....))))))).)))))...(((((.(((((((..(((....)))...))))))).))))).........---------- ( -23.60, z-score = -1.43, R) >consensus UGCCUGUGUGCAAUGUGUUGCAAGUUGCAUUGGCAGCGUCAUUCAAGUGUUUAGUGAUUUAUUGAAUGCCGUUAGAGUUGUCGUUGUUUC___ .(((...(((((((.((...)).))))))).)))((((.(((((((..(((....)))...))))))).)))).................... (-20.56 = -20.83 + 0.27)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:23:23 2011