| Sequence ID | dm3.chrX |
|---|---|
| Location | 7,247,240 – 7,247,306 |
| Length | 66 |
| Max. P | 0.562150 |
| Location | 7,247,240 – 7,247,306 |
|---|---|
| Length | 66 |
| Sequences | 6 |
| Columns | 66 |
| Reading direction | reverse |
| Mean pairwise identity | 98.69 |
| Shannon entropy | 0.02376 |
| G+C content | 0.26515 |
| Mean single sequence MFE | -9.78 |
| Consensus MFE | -9.50 |
| Energy contribution | -9.67 |
| Covariance contribution | 0.17 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.09 |
| Structure conservation index | 0.97 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.14 |
| SVM RNA-class probability | 0.562150 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 7247240 66 - 22422827 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCUG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.90, z-score = -1.33, R) >droSim1.chrX 5783922 66 - 17042790 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCUG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.90, z-score = -1.33, R) >droSec1.super_24 456840 66 - 912625 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCGG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.90, z-score = -0.79, R) >droYak2.chrX 7665898 66 + 21770863 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCUG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.90, z-score = -1.33, R) >droEre2.scaffold_4690 16153293 66 - 18748788 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCUG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.90, z-score = -1.33, R) >droAna3.scaffold_13117 91617 66 - 5790199 CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUGUUGUUGAUUUAUUGAAAUUGCCCGG ..(((((((..(.((((...(((((((....)).))))))))).)..)))))))............ ( -9.20, z-score = -0.43, R) >consensus CAAAUGAGUUGAAGACAAAUUUUUGAAUUAUUUGCAAAAUUUUGUUGAUUUAUUGAAAUUGCCCUG ..((((((((...((((((.(((((((....)).))))).))))))))))))))............ ( -9.50 = -9.67 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:23:06 2011