| Sequence ID | dm3.chrX |
|---|---|
| Location | 7,236,255 – 7,236,345 |
| Length | 90 |
| Max. P | 0.842847 |
| Location | 7,236,255 – 7,236,345 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 106 |
| Reading direction | reverse |
| Mean pairwise identity | 74.14 |
| Shannon entropy | 0.40824 |
| G+C content | 0.49051 |
| Mean single sequence MFE | -25.34 |
| Consensus MFE | -15.26 |
| Energy contribution | -16.14 |
| Covariance contribution | 0.88 |
| Combinations/Pair | 1.18 |
| Mean z-score | -1.77 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.88 |
| SVM RNA-class probability | 0.842847 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 7236255 90 - 22422827 ----------------CUUUCUGUCGGUCUUCCCUUUCCCGUUCCCGUUCCUUUUGAUAAUUACUAAAGUUGUGCUUGCGCAACUUGGAGGCGGGAUACGUAGUGG ----------------...............((((.((((((..((..((.....)).........((((((((....))))))))))..)))))).....)).)) ( -23.60, z-score = -1.22, R) >droSec1.super_24 445662 84 - 912625 ----------------CUUUCCGCCGGUCUUCCCU------UUCCCGUUCCUUUUGGUAGUUAGUAAAGUUGUGCUUGCGCAACUUGGAGGCGGGAUACGUACUGG ----------------..(((((((((....))..------.(((....((....)).........((((((((....)))))))))))))))))).......... ( -25.30, z-score = -1.11, R) >droYak2.chrX 7654634 100 + 21770863 UUAUAAUAAUAAUAAUCUUUCUGCCGGUCUUCCCU------UUCCCAUUCCUUUUGGUAGUUACUAAAGUUGUGCUUGCGCAUCUUGGAGGCGGGAUACGUACUGG .......................((((((.(((((------((((.........((((....))))(((.((((....)))).)))))))).))))...).))))) ( -21.40, z-score = -0.26, R) >droEre2.scaffold_4690 16142615 84 - 18748788 ----------------CUUUCUGCCGGUCUUCCUU------UUCCCAUUCCUUUUGGUAAUUACUAAAGUUGUGUUUGCGCAACUUGGAGGCGGGAUACGUGUUGG ----------------..(((((((((....))..------.......(((...((((....))))((((((((....)))))))))))))))))).......... ( -24.00, z-score = -2.01, R) >droAna3.scaffold_13117 78310 81 - 5790199 -------------------CCCUCUGCUUCUCCCG------CUCCCUUUCCUUUUGGUAGCUGCUAAAAUUGUGUUUCCGCAACUUUGGCGCGGGGAAGUUCCGGG -------------------(((...(((((.((((------(...((..((....)).))..((((((.(((((....))))).))))))))))))))))...))) ( -32.40, z-score = -4.28, R) >consensus ________________CUUUCUGCCGGUCUUCCCU______UUCCCAUUCCUUUUGGUAGUUACUAAAGUUGUGCUUGCGCAACUUGGAGGCGGGAUACGUACUGG ..................(((((((((....)).........(((....((....)).........((((((((....)))))))))))))))))).......... (-15.26 = -16.14 + 0.88)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:23:04 2011