| Sequence ID | dm3.chrX |
|---|---|
| Location | 6,630,850 – 6,630,918 |
| Length | 68 |
| Max. P | 0.650819 |
| Location | 6,630,850 – 6,630,918 |
|---|---|
| Length | 68 |
| Sequences | 7 |
| Columns | 73 |
| Reading direction | reverse |
| Mean pairwise identity | 72.05 |
| Shannon entropy | 0.56470 |
| G+C content | 0.35290 |
| Mean single sequence MFE | -15.75 |
| Consensus MFE | -6.61 |
| Energy contribution | -7.14 |
| Covariance contribution | 0.54 |
| Combinations/Pair | 1.47 |
| Mean z-score | -1.49 |
| Structure conservation index | 0.42 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.34 |
| SVM RNA-class probability | 0.650819 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 6630850 68 - 22422827 CGAAUGCGACUGCUUUAAU---UGUGCAAUUAGCUGCAUAAUUGCAAUGCUCUGAA--UGAUCACGUAUUCAA .(((((((..(((...(((---((((((......)))))))))))).((.((....--.)).))))))))).. ( -19.60, z-score = -2.52, R) >droAna3.scaffold_13117 4400605 65 - 5790199 UGGAAAUUGUGGACUUAAU---UGUACAAUUAGCUGCAUAAUUGUAUGCUUCUG----GGGCUGGGCUUCCA- .((((((((((.(.(((((---(....)))))).).)))))))((..(((....----.)))...)).))).- ( -13.90, z-score = -0.03, R) >droEre2.scaffold_4690 15556733 59 - 18748788 CGAAUGCAACUGCUUUAAUUGUUGUUUAAUUAGCUGCAUAAUUGCA--------------AUCACGUAUUCAA .((((((....(((..(((((.....))))))))((((....))))--------------.....)))))).. ( -13.10, z-score = -1.68, R) >droYak2.chrX 2593543 68 - 21770863 CGAAUGCAACUGCUUUAAU---UGUGCAAUUAGCUGCAUAAUUGCAAUGCUCUGAA--UGAUCACGUAUUCAA .((((((...(((...(((---((((((......)))))))))))).((.((....--.)).)).)))))).. ( -17.60, z-score = -1.87, R) >droSec1.super_4 6015759 68 + 6179234 CGAAUGCAACUGCUUUAAU---UGUGCAAUUAGCUGCAUAAUUGCAAUGCUAUGAA--UGAUCACGUAUUCAA .((((((....((..((((---((((((......))))))))))....))..(((.--...))).)))))).. ( -17.40, z-score = -1.53, R) >droSim1.chrX 5222660 68 - 17042790 CGAAUGCAACUGCUUUAAU---UGUGCAAUUAGCUGCAUAAUUGCAAUGCUCUGAA--UGAUCACGUAUUCAA .((((((...(((...(((---((((((......)))))))))))).((.((....--.)).)).)))))).. ( -17.60, z-score = -1.87, R) >droWil1.scaffold_180777 4731594 61 + 4753960 ---------CUAUUGUAAU---UGUGCAAUUAGCUGCAUAAUUAAAUUGUUUGAAAAUUGAAUACGAAAGCAA ---------......((((---((((((......))))))))))..((((((...............)))))) ( -11.06, z-score = -0.90, R) >consensus CGAAUGCAACUGCUUUAAU___UGUGCAAUUAGCUGCAUAAUUGCAAUGCUCUGAA__UGAUCACGUAUUCAA .((((((.................((((((((......)))))))).......(........)..)))))).. ( -6.61 = -7.14 + 0.54)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:21:40 2011