| Sequence ID | dm3.chrX |
|---|---|
| Location | 6,308,855 – 6,308,956 |
| Length | 101 |
| Max. P | 0.901464 |
| Location | 6,308,855 – 6,308,956 |
|---|---|
| Length | 101 |
| Sequences | 4 |
| Columns | 111 |
| Reading direction | forward |
| Mean pairwise identity | 80.60 |
| Shannon entropy | 0.29253 |
| G+C content | 0.41805 |
| Mean single sequence MFE | -28.80 |
| Consensus MFE | -16.83 |
| Energy contribution | -17.82 |
| Covariance contribution | 1.00 |
| Combinations/Pair | 1.16 |
| Mean z-score | -2.57 |
| Structure conservation index | 0.58 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.16 |
| SVM RNA-class probability | 0.901464 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 6308855 101 + 22422827 UCCCCCGGUGG---UGUUUUUUUUUGUCCUUUUCUUUUAUUUUGCUUUUUUGUUCUGUUGCCAAAAAGUGAAAGAAGUGAAAUGCGAUGAAAGCGUUGGUGGGU------- ...((((.(..---(((((((..((((...((((.(((.(((..((((((.((......)).))))))..))).))).)))).)))).)))))))..).)))).------- ( -28.30, z-score = -3.18, R) >droSim1.chrX 4950580 97 + 17042790 UCCCCCGGUGC---UGUUUUUUU----CCAUUUCUUUUAUUUUGCUUUUUUGUUCUGUUGCCAAAAAGUGAAAGAAGUGAAAUGCGAUGAAAGCGUUGGUGGGC------- .(((((..(((---(.(((...(----(((((((.(((.(((..((((((.((......)).))))))..))).))).)))))).)).)))))))..)).))).------- ( -31.20, z-score = -3.91, R) >droSec1.super_4 5708458 98 - 6179234 UCCCCCGGUGC---UGUUUUUUU----CCAUUUCUUUUAUUUUGUUUUUU------GUUGCCAAAAAGUGAAAGAAGUGAAAUGCGAUGAAAGCGAUGGUGGGCGGUGGGG ..(((((.(((---(((((((.(----(((((((.(((.(((..((((((------(....)))))))..))).))).)))))).)).)))))).......)))).))))) ( -32.31, z-score = -2.78, R) >droEre2.scaffold_4690 15263102 101 + 18748788 UCCCUCGGUGGAAAUGUUUUUUCUUG-CCUUUCUUUCUGCUCUGUUCUGU---GCUGUUGCCAAAAAGUGAAAGAAGUGAAAUGCGAUGAAAGCGUUGGUGGCGG------ .....((.((..(((((((((..(((-(.(((((((((..((..((.((.---((....)))).))...)).))))).)))).)))).)))))))))..)).)).------ ( -23.40, z-score = -0.42, R) >consensus UCCCCCGGUGC___UGUUUUUUU____CCAUUUCUUUUAUUUUGCUUUUU___UCUGUUGCCAAAAAGUGAAAGAAGUGAAAUGCGAUGAAAGCGUUGGUGGGC_______ .(((((......................(((((((((((((((.....................))))))))))))))).(((((.......))))))).)))........ (-16.83 = -17.82 + 1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:20:33 2011