| Sequence ID | dm3.chrX |
|---|---|
| Location | 6,240,434 – 6,240,489 |
| Length | 55 |
| Max. P | 0.947003 |
| Location | 6,240,434 – 6,240,489 |
|---|---|
| Length | 55 |
| Sequences | 3 |
| Columns | 55 |
| Reading direction | reverse |
| Mean pairwise identity | 90.91 |
| Shannon entropy | 0.12900 |
| G+C content | 0.52424 |
| Mean single sequence MFE | -3.17 |
| Consensus MFE | -3.10 |
| Energy contribution | -3.10 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.64 |
| Structure conservation index | 0.98 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.53 |
| SVM RNA-class probability | 0.947003 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 6240434 55 - 22422827 CUACCCCCACACCUCCAAAAACGACCUUGAACCAAUUAUCGCCGAUUGACGAGCG .......................................(((((.....)).))) ( -3.30, z-score = -1.30, R) >droSec1.super_4 5649077 54 + 6179234 CAA-CCCCCCACCAACAAAAACGACCUUGAACCAAUUAUCACCGAUUGACGAGCG ...-.....................((((...(((((......))))).)))).. ( -3.10, z-score = -2.30, R) >droSim1.chrX_random 2025620 55 - 5698898 CAACCCCCCCACCAGCAGAAACGACCUUGAACCAAUUAUCACCGAUUGACGAGCG .........................((((...(((((......))))).)))).. ( -3.10, z-score = -1.31, R) >consensus CAACCCCCCCACCAACAAAAACGACCUUGAACCAAUUAUCACCGAUUGACGAGCG .........................((((...(((((......))))).)))).. ( -3.10 = -3.10 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:20:23 2011