| Sequence ID | dm3.chrX |
|---|---|
| Location | 6,030,453 – 6,030,566 |
| Length | 113 |
| Max. P | 0.515952 |
| Location | 6,030,453 – 6,030,566 |
|---|---|
| Length | 113 |
| Sequences | 5 |
| Columns | 113 |
| Reading direction | reverse |
| Mean pairwise identity | 91.73 |
| Shannon entropy | 0.14256 |
| G+C content | 0.34444 |
| Mean single sequence MFE | -26.24 |
| Consensus MFE | -23.32 |
| Energy contribution | -23.20 |
| Covariance contribution | -0.12 |
| Combinations/Pair | 1.09 |
| Mean z-score | -1.25 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.04 |
| SVM RNA-class probability | 0.515952 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 6030453 113 - 22422827 UUCACAAAAUAAAUUUAUUUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGAGCGUAUUUUAACAUUUUUGAUUUGGUUUGGCAAGUCU ..((.((((((....)))))).))((((((....(((((((((((.......))))))..)))))....))))))...................((((((......)))))). ( -25.00, z-score = -0.87, R) >droEre2.scaffold_4690 15009235 108 - 18748788 UUCGCAAAAUAAAUUUA-UUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGACCGAAUAUUAAGA----UGAUUUGGUUUGAUGAGUCU ...((((((........-.))))))(((((....(((((((((((.......))))))..)))))....)))))((((((((.......----..)))))))).......... ( -28.50, z-score = -2.12, R) >droYak2.chrX 2040393 108 - 21770863 UUCGGAAAAUAAAUUUA-UUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGAGCGCAUUUCAACA----UGAUUUGUUUUGGCAAGUCU ....(((((((....))-))))).((((((....(((((((((((.......))))))..)))))....))))))..............----.(((((((....))))))). ( -27.50, z-score = -1.18, R) >droSec1.super_4 5444124 113 + 6179234 UUCACAAAAUAAAUUUAUUUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGAGCGUAUUUUAACAUUUUUGAUUUGGUUUAGCAAGUCU ..((.((((((....)))))).))((((((....(((((((((((.......))))))..)))))....))))))...................((((((......)))))). ( -25.00, z-score = -1.05, R) >droSim1.chrX 4755503 113 - 17042790 UUCACAAAAUAGAUUUAUUUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGAGCGUAUUUUAACAUUUUUGAUUUGGUUUAGCAAGACU ...................(((((((((((....(((((((((((.......))))))..)))))....)))))((((.((..((((.....))))..)))))).)))))).. ( -25.20, z-score = -1.04, R) >consensus UUCACAAAAUAAAUUUAUUUUUUGCGGCUGACUUUUGCUUUGCAUAAUUAUCGUGCAACUGGCAAUUUGCAGUCGAGCGUAUUUUAACAUUUUUGAUUUGGUUUGGCAAGUCU ........................((((((....(((((((((((.......))))))..)))))....))))))...................((((((......)))))). (-23.32 = -23.20 + -0.12)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:19:47 2011