| Sequence ID | dm3.chrX |
|---|---|
| Location | 5,935,818 – 5,935,881 |
| Length | 63 |
| Max. P | 0.657063 |
| Location | 5,935,818 – 5,935,881 |
|---|---|
| Length | 63 |
| Sequences | 7 |
| Columns | 67 |
| Reading direction | reverse |
| Mean pairwise identity | 76.97 |
| Shannon entropy | 0.45083 |
| G+C content | 0.54022 |
| Mean single sequence MFE | -18.51 |
| Consensus MFE | -11.35 |
| Energy contribution | -12.04 |
| Covariance contribution | 0.70 |
| Combinations/Pair | 1.29 |
| Mean z-score | -1.25 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.35 |
| SVM RNA-class probability | 0.657063 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 5935818 63 - 22422827 UCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGUCAGUGGUUGUUAU--GGCCAUUG-UUAGCCCACAG ..(((((.....))))).......((-((.((((((((((.....--))))))))-...)).)))). ( -22.90, z-score = -2.64, R) >droSim1.chrX 4663659 63 - 17042790 UCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGUCAGUGGUUGUUAU--GGCCAUUG-UUAGCCCACAG ..(((((.....))))).......((-((.((((((((((.....--))))))))-...)).)))). ( -22.90, z-score = -2.64, R) >droSec1.super_4 5349969 63 + 6179234 UCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGUCAGUGGUUGUUAU--GGCUAUUG-UUACCCCACAC ..(((((.....)))))........(-((((.((((((((.....--))))))))-......))))) ( -19.90, z-score = -1.38, R) >droYak2.chrX 14794236 64 - 21770863 GCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGUCAGUGGUUGUUAU--GGCCAUUGUUUGGCCCACAG (.(((((.....))))))......((-((.((((((((((.....--))))))....)))).)))). ( -23.00, z-score = -1.62, R) >droEre2.scaffold_4690 3270740 63 - 18748788 UCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGUCAGUGGUUGUUAU--GCCCAUUG-UUAGUCCACAG ..(((((.....))))).......((-((.(.((((((.......--..))))))-.....))))). ( -18.00, z-score = -1.66, R) >droAna3.scaffold_12929 242531 60 - 3277472 GCGCCGGAAGUUCCGGCCGGAAAAUG-UGUGCCCGUGGUUGUCGUCAAGCCAUUG-UUACGG----- (.(((((.....))))))........-((((.(.((((((.......)))))).)-.)))).----- ( -18.40, z-score = -0.22, R) >droMoj3.scaffold_6473 95039 63 - 16943266 UUGCCUGGAAACCCGUUCGAUAAUUGACUCGUCCGCCUCUUUGUU--GCCCCUUG-UUGUUGUUCA- ..((..(((....((..(((........)))..))..)))..)).--........-..........- ( -4.50, z-score = 1.44, R) >consensus UCGCCGGAAGUUCCGGCCGGAAAAUG_UGUGUCAGUGGUUGUUAU__GGCCAUUG_UUAGCCCACAG ..((((((...))))))...............((((((((.......))))))))............ (-11.35 = -12.04 + 0.70)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:19:28 2011