| Sequence ID | dm3.chr2L |
|---|---|
| Location | 10,181,418 – 10,181,470 |
| Length | 52 |
| Max. P | 0.516903 |
| Location | 10,181,418 – 10,181,470 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 81.39 |
| Shannon entropy | 0.35964 |
| G+C content | 0.41975 |
| Mean single sequence MFE | -12.33 |
| Consensus MFE | -9.17 |
| Energy contribution | -8.73 |
| Covariance contribution | -0.44 |
| Combinations/Pair | 1.50 |
| Mean z-score | -1.10 |
| Structure conservation index | 0.74 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.04 |
| SVM RNA-class probability | 0.516903 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 10181418 52 - 23011544 UCCAUUUAACUGCUCUUCGUGGAGU--UGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.((((......--)))).)))))).))))).......... ( -13.50, z-score = -1.82, R) >droSim1.chr2L 9964174 52 - 22036055 UCCAUUUAACUGCUCUUUGUCGAGU--UGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.((((......--)))).)))))).))))).......... ( -10.70, z-score = -0.82, R) >droSec1.super_3 5606672 52 - 7220098 UCCAUUUAACUGCUCUUUGUCGAGU--AGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.(((.......--.))).)))))).))))).......... ( -10.50, z-score = -0.84, R) >droYak2.chr2L 12853906 52 - 22324452 UCCAUUUAACUGCUCUUUGUGAAGU--UGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.((((......--)))).)))))).))))).......... ( -10.70, z-score = -1.11, R) >droEre2.scaffold_4929 10786415 52 - 26641161 UCCAUUUAACUGCUCUUUGUUGAGU--UGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.((((......--)))).)))))).))))).......... ( -10.70, z-score = -0.96, R) >droVir3.scaffold_12723 2095128 54 + 5802038 UUCGCUUUGCCGUUUUUGCCAGUGUGGUAAAACGCGCUGAAGUGCGCAACGUGU ..(((.((((.(((((.(((.....))))))))((((....)))))))).))). ( -17.90, z-score = -1.03, R) >consensus UCCAUUUAACUGCUCUUUGUCGAGU__UGAAAAGCGGUGAGGUGCAUAAAAGAU ..(((((.((((((.(((..........))).)))))).))))).......... ( -9.17 = -8.73 + -0.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:29:47 2011