| Sequence ID | dm3.chrX |
|---|---|
| Location | 5,082,096 – 5,082,164 |
| Length | 68 |
| Max. P | 0.556486 |
| Location | 5,082,096 – 5,082,164 |
|---|---|
| Length | 68 |
| Sequences | 6 |
| Columns | 68 |
| Reading direction | reverse |
| Mean pairwise identity | 81.76 |
| Shannon entropy | 0.35443 |
| G+C content | 0.35850 |
| Mean single sequence MFE | -14.80 |
| Consensus MFE | -9.95 |
| Energy contribution | -11.12 |
| Covariance contribution | 1.17 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.41 |
| Structure conservation index | 0.67 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.13 |
| SVM RNA-class probability | 0.556486 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 5082096 68 - 22422827 UAAAAACUAUCCAGAUACCUGGAAUACCUGAUUUUUGUCUAGGGAUUUGAAUUGGGGACUUCAUAAAU .........(((((....)))))...((..((((..(((....)))..))))..))............ ( -17.20, z-score = -2.01, R) >droSim1.chrX_random 1763534 68 - 5698898 UACAAACUAUCCAGAUACCUGGAAUACCUGAUUUUUGUCUUGGGAUUGGAAUUGGGGACUUCAUAAAU .........(((((....)))))...((..((((..(((....)))..))))..))............ ( -17.40, z-score = -1.82, R) >droSec1.super_4 4505979 68 + 6179234 UAAAAACUAUCCAGAUACCUGGAAUACCUGAUUUUUGUCUAGGGAUUGGAAUUGGGGACUUCAUAAAU .........(((((....)))))...((..((((..(((....)))..))))..))............ ( -17.40, z-score = -1.76, R) >droYak2.chrX 18385581 66 + 21770863 AAAAAACUAUCCAGAUACCUGGAAUACCUUAUUUUUGUUUUGGGAUUUGAAUUGGGA--UUCAUAAAU .........(((((....)))))...(((.((((..(((....)))..)))).))).--......... ( -11.60, z-score = -0.23, R) >droEre2.scaffold_4690 2437371 64 - 18748788 --AAAACUAUCCAGAUACCUGGAAUACCUGAUUUUUGUUUUGGGAUUUGUAUUGGGA--UUCAUAAAU --......((((.(((((...((((.((..(........)..))))))))))).)))--)........ ( -11.90, z-score = -0.40, R) >droAna3.scaffold_13117 2513731 61 - 5790199 GACAAACUGUCCAGAUACCUGG-AUACCCCAUUUCCGGACCUG---UCGCCUCUGA---UUCACAAAU ((((...(((((((....))))-)))..((......))...))---))........---......... ( -13.30, z-score = -2.26, R) >consensus UAAAAACUAUCCAGAUACCUGGAAUACCUGAUUUUUGUCUUGGGAUUUGAAUUGGGG__UUCAUAAAU .........(((((....)))))...((..((((..(((....)))..))))..))............ ( -9.95 = -11.12 + 1.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:16:59 2011