| Sequence ID | dm3.chrX |
|---|---|
| Location | 4,120,002 – 4,120,064 |
| Length | 62 |
| Max. P | 0.908005 |
| Location | 4,120,002 – 4,120,064 |
|---|---|
| Length | 62 |
| Sequences | 6 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 72.85 |
| Shannon entropy | 0.51518 |
| G+C content | 0.36374 |
| Mean single sequence MFE | -11.80 |
| Consensus MFE | -7.79 |
| Energy contribution | -7.43 |
| Covariance contribution | -0.36 |
| Combinations/Pair | 1.53 |
| Mean z-score | -1.20 |
| Structure conservation index | 0.66 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.20 |
| SVM RNA-class probability | 0.908005 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 4120002 62 + 22422827 AUGUCGAUCAGUCAGAUGCUUCAUUUGGUAAAAUCAAAUGGAUGGGCAGGCAUUUUAAAGAA (((((((....))...(((((((((((((...)))))))))...)))))))))......... ( -12.80, z-score = -1.11, R) >droEre2.scaffold_4690 1489289 58 + 18748788 AUGCCGAUUACCCAGAUGCUUCAUUUGGUAAAAUCAAAUGGAC----AGGCACUUUAAAGAA .(((((......)...((.((((((((((...)))))))))))----))))).......... ( -12.20, z-score = -1.37, R) >droYak2.chrX 17453550 58 - 21770863 AUGCCGAUUACCCAGUUGCUUCAUUUGGUAAAAUCAAAUGGAA----AGGCACUUUAAAGAA .((((((((....))))..((((((((((...)))))))))).----.)))).......... ( -11.90, z-score = -1.08, R) >droSec1.super_4 3567578 58 - 6179234 AUGCCCAUCAGCCAGAUGCUUCAUUUGGUAAAAUCAAAUGGAU----AGGCACUUUAAAGAA .((((((((.....)))).((((((((((...)))))))))).----.)))).......... ( -14.50, z-score = -1.72, R) >droSim1.chrX 3084921 58 + 17042790 AUGCCCAUCAGCCAGAUGCUUCAUUUGGUAAAAUCAAAUGGAU----AGGCACUUUAAAGAA .((((((((.....)))).((((((((((...)))))))))).----.)))).......... ( -14.50, z-score = -1.72, R) >droWil1.scaffold_181150 2281815 61 + 4952429 -GAGUUACUAAUCAAGCACUUGCAAUUAUACAAUUAAUUAAACUAACAGCAAUUCCAACUGC -(((((.((......((....))(((((......)))))........)).)))))....... ( -4.90, z-score = -0.17, R) >consensus AUGCCGAUCAGCCAGAUGCUUCAUUUGGUAAAAUCAAAUGGAU____AGGCACUUUAAAGAA .((((.(((.....)))..((((((((((...))))))))))......)))).......... ( -7.79 = -7.43 + -0.36)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:13:49 2011