| Sequence ID | dm3.chrX |
|---|---|
| Location | 4,089,203 – 4,089,297 |
| Length | 94 |
| Max. P | 0.858305 |
| Location | 4,089,203 – 4,089,297 |
|---|---|
| Length | 94 |
| Sequences | 5 |
| Columns | 116 |
| Reading direction | forward |
| Mean pairwise identity | 79.28 |
| Shannon entropy | 0.32687 |
| G+C content | 0.42968 |
| Mean single sequence MFE | -19.58 |
| Consensus MFE | -14.02 |
| Energy contribution | -14.22 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.79 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.94 |
| SVM RNA-class probability | 0.858305 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 4089203 94 + 22422827 UUUUUUUUCCCGAUUUCGGGCUUAAUCAAACCAAACGGAAGCAAACUCAAUUUGCUUUACAUUCG-----------------AAAACAAUUUGAGGCAGCCCC-UCCACACA---- .................(((((...(((((((....))(((((((.....)))))))........-----------------.......)))))...))))).-........---- ( -18.50, z-score = -1.94, R) >droEre2.scaffold_4690 1459740 109 + 18748788 ACCUUUCUCCCGAUUUCGGGAUUAAUCAAACCAAUCGGAAGCAAACUCAAUUUGCUU-GCAUUCCUGCACUCUCAGGCCCCAAAAACAAUUUGACGAAGCCCCCUCCACA------ ...(((((((((....)))))....(((((......(.(((((((.....)))))))-.)...((((......))))............))))).))))...........------ ( -22.20, z-score = -1.97, R) >droYak2.chrX 17422899 108 - 21770863 ACCUUUUUCCCGAUUACAGGAUUAAUCAAACCAAUCGGAAGCAAAUUCAAUUUGCUUUACAUUCCUGCGCUCUCAGGCCC-AGAAACAAUUUGAGGAAGCCCC-UCCACA------ .........((((((....((....)).....))))))((((((((...)))))))).......(((.(((....))).)-)).........((((.....))-))....------ ( -21.00, z-score = -1.21, R) >droSec1.super_4 3537538 97 - 6179234 ACCUUUUUUCCGAUUUCGGGCUUAAUCAAACCAAUCGGAAGCAAACUCAAUUUGCUUUACAUUCC-----------------AAAACAAUUUGGG-CAGCCCC-UCCACACACACA .................(((((...............((((((((.....))))))))....(((-----------------(((....))))))-.))))).-............ ( -18.80, z-score = -2.46, R) >droSim1.chrX 3053243 98 + 17042790 ACCUUUUUUCCGAUUUCGGGCUUAAUCAAACCAAUCGGAAGCAAACUCAAUUUGCUUUACAUUCC-----------------AAAACAAUUUGGGGCAGUCCC-UCCACACACACA .......((((((((..((...........))))))))))(((((.....)))))..........-----------------.........(((((......)-))))........ ( -17.40, z-score = -1.37, R) >consensus ACCUUUUUCCCGAUUUCGGGCUUAAUCAAACCAAUCGGAAGCAAACUCAAUUUGCUUUACAUUCC_________________AAAACAAUUUGAGGCAGCCCC_UCCACACA____ .................(((((...(((((((....))(((((((.....)))))))................................)))))...))))).............. (-14.02 = -14.22 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:13:41 2011