| Sequence ID | dm3.chrX |
|---|---|
| Location | 3,933,582 – 3,933,676 |
| Length | 94 |
| Max. P | 0.728837 |
| Location | 3,933,582 – 3,933,676 |
|---|---|
| Length | 94 |
| Sequences | 3 |
| Columns | 96 |
| Reading direction | reverse |
| Mean pairwise identity | 80.81 |
| Shannon entropy | 0.24871 |
| G+C content | 0.71438 |
| Mean single sequence MFE | -32.97 |
| Consensus MFE | -22.77 |
| Energy contribution | -23.00 |
| Covariance contribution | 0.23 |
| Combinations/Pair | 1.09 |
| Mean z-score | -2.03 |
| Structure conservation index | 0.69 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.52 |
| SVM RNA-class probability | 0.728837 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 3933582 94 - 22422827 CAGGGGCGUGGCUGGGCGUGG--GGGGUUCCUUCGAUGGGGCCAAUGGGGUCCUUUUCAGGGGGGAGGGGGUCAGGGGGUCAGGGGGCGACGCUUG ...((((((.(((...(((.(--(((....)))).))).((((....((.(((((..(....)..))))).))....))))....))).)))))). ( -38.00, z-score = -2.39, R) >droSim1.chrX 2915413 79 - 17042790 CAGGGGCGUGGCUGGGCGGGGGCGGGGUUACUUCGAUGGGGCCAAUAGGGCCUUU----------------UCGGGGGGUCA-GGGGCGACGCUUG ...((((((.(((..((....)).......((((((..(((((.....)))))..----------------)))))).....-..))).)))))). ( -32.70, z-score = -2.49, R) >droSec1.super_4 3391732 79 + 6179234 CAGGGGCGUGGGUGGGCGGGGGCGGGGUUACUUCGAUGGGGCCAAUGGGGCCUUU----------------UCGGGGGGUCA-GGGGCGACGCUUG ...((((((.(.(..((....)).......((((((..(((((.....)))))..----------------)))))).....-..).).)))))). ( -28.20, z-score = -1.21, R) >consensus CAGGGGCGUGGCUGGGCGGGGGCGGGGUUACUUCGAUGGGGCCAAUGGGGCCUUU________________UCGGGGGGUCA_GGGGCGACGCUUG ...((((((.(((.(((.....(((((...)))))..((((((.....))))))........................)))....))).)))))). (-22.77 = -23.00 + 0.23)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:13:15 2011