| Sequence ID | dm3.chrX |
|---|---|
| Location | 3,743,203 – 3,743,303 |
| Length | 100 |
| Max. P | 0.665959 |
| Location | 3,743,203 – 3,743,303 |
|---|---|
| Length | 100 |
| Sequences | 4 |
| Columns | 105 |
| Reading direction | reverse |
| Mean pairwise identity | 74.72 |
| Shannon entropy | 0.40376 |
| G+C content | 0.30231 |
| Mean single sequence MFE | -16.37 |
| Consensus MFE | -11.12 |
| Energy contribution | -11.06 |
| Covariance contribution | -0.06 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.26 |
| Structure conservation index | 0.68 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.38 |
| SVM RNA-class probability | 0.665959 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 3743203 100 - 22422827 GCCAAGACCGUUCUUUAAUUAUCUUAAAAAUGUCGAAAGGGC----AAUAAGUAUAUAUGCUAAACAAUUUUCCCUUUCGAAUAACAAACAUAAGAUAUUUUAA- ...................(((((((......(((((((((.----((..((((....)))).......)).)))))))))..........)))))))......- ( -16.29, z-score = -2.11, R) >droYak2.chrX 17096736 80 + 21770863 -----------------AUCAUGUUAAACAUGUCAAAAGGGC----AAUAAGUAUAUAUGGUAACUUUAUUUCCCUUUUAAAUAACAAAC----CAUCUUUUCAA -----------------..((((.....))))..(((((((.----(((((.(((.....)))...))))).)))))))...........----........... ( -12.00, z-score = -1.73, R) >droSec1.super_4 3208925 103 + 6179234 GCCAAGACCGUGCGUUUAUCAUCUUAAGCAUGUCAGAAGGGC-AAAAAAAAGUAUUUAUGCUGGGCAAUUUUCCCUUUUGAAUAACAAACAUAACAUAUUUUAA- ........(((((..............)))))(((((((((.-((((...((((....))))......))))))))))))).......................- ( -18.44, z-score = -0.45, R) >droSim1.chrX 2748899 104 - 17042790 GCCAAGACCGUGCGUUUAUCAUCUUAAGCAUGUCAAAAGGGCAAAAAAAAAGUAUUUAUGCUGGGCAAUUUUCCCUUUUGAAUAACAAACAUAACAUAUUUUAA- ........(((((..............)))))(((((((((.((((....((((....))))......))))))))))))).......................- ( -18.74, z-score = -0.76, R) >consensus GCCAAGACCGUGCGUUUAUCAUCUUAAACAUGUCAAAAGGGC____AAAAAGUAUAUAUGCUAAGCAAUUUUCCCUUUUGAAUAACAAACAUAACAUAUUUUAA_ ................................(((((((((.........((((....))))..........)))))))))........................ (-11.12 = -11.06 + -0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:12:26 2011