| Sequence ID | dm3.chrX |
|---|---|
| Location | 3,097,988 – 3,098,038 |
| Length | 50 |
| Max. P | 0.938751 |
| Location | 3,097,988 – 3,098,038 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | reverse |
| Mean pairwise identity | 93.33 |
| Shannon entropy | 0.09183 |
| G+C content | 0.32667 |
| Mean single sequence MFE | -11.13 |
| Consensus MFE | -10.65 |
| Energy contribution | -10.77 |
| Covariance contribution | 0.11 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.81 |
| Structure conservation index | 0.96 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.45 |
| SVM RNA-class probability | 0.938751 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 3097988 50 - 22422827 CAGCUGUUAAUUUUUAAACAAUUAGCUUGAUUACGCUUUAUGAGCAGCAA ..((((((((((.......)))))))........((((...))))))).. ( -8.60, z-score = -0.36, R) >droSec1.super_10 2819015 50 - 3036183 CAGCUGUUCAUUUAUAAACAAUUAAGUUGAUUACGCUUUAUGGGCAGCAA ..(((((((((...(((.((((...)))).)))......))))))))).. ( -11.90, z-score = -2.30, R) >droSim1.chrX 2201206 50 - 17042790 CAGCUGUUCAUUUAUAAACAAUUAAGUUGAUUACGCUUUAUGAGCAGCAA ..(((((((((...(((.((((...)))).)))......))))))))).. ( -12.90, z-score = -2.77, R) >consensus CAGCUGUUCAUUUAUAAACAAUUAAGUUGAUUACGCUUUAUGAGCAGCAA ..(((((((((...(((.(((.....))).)))......))))))))).. (-10.65 = -10.77 + 0.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:10:54 2011