| Sequence ID | dm3.chrX |
|---|---|
| Location | 2,944,492 – 2,944,561 |
| Length | 69 |
| Max. P | 0.725787 |
| Location | 2,944,492 – 2,944,561 |
|---|---|
| Length | 69 |
| Sequences | 6 |
| Columns | 74 |
| Reading direction | reverse |
| Mean pairwise identity | 90.24 |
| Shannon entropy | 0.17624 |
| G+C content | 0.33072 |
| Mean single sequence MFE | -9.53 |
| Consensus MFE | -8.23 |
| Energy contribution | -8.45 |
| Covariance contribution | 0.22 |
| Combinations/Pair | 1.08 |
| Mean z-score | -1.57 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.725787 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 2944492 69 - 22422827 UACACCUGCUUAAUUUAUGCUCGACC----AGCUACUGCAGCAUAAAUUAUCUUUAUC-AUUCCCAUAAUAUUA ..........(((((((((((.....----.((....)))))))))))))........-............... ( -10.30, z-score = -2.55, R) >droSim1.chrX 2081965 73 - 17042790 UACACCUGCUUAAUUUAUGCUCGACCAGCUAGCUACUGCAGCAUAAAUUAUCUUUAUC-AUUCCCAUAAUAUUA ..........(((((((((((....(((.......))).)))))))))))........-............... ( -10.80, z-score = -1.72, R) >droSec1.super_10 2684219 73 - 3036183 UACACCUGCUUAAUUUAUGCUCGACCAGCUAGCUACUGCAGCAUAAAUUAUCUUUAUC-AUUCCCAUAAUAUUA ..........(((((((((((....(((.......))).)))))))))))........-............... ( -10.80, z-score = -1.72, R) >droYak2.chrX 16351875 69 + 21770863 UACACCUGCUUAAUUUAUGCUCGACC----AGCUACUGCAGCAUAAAUUAUCUUUAUC-AUAUCCAUAAUAUUA ..........(((((((((((.....----.((....)))))))))))))........-............... ( -10.30, z-score = -2.18, R) >droEre2.scaffold_4690 372514 70 - 18748788 UACACCUGCCUAAUUUAUGCUCGACC----AGCUACUGCAGCAUAAAUUAUCUUUAUCAAUACCCAUAAUAUUA ..........(((((((((((.....----.((....)))))))))))))........................ ( -10.20, z-score = -2.64, R) >droAna3.scaffold_12613 17903 69 + 519072 UACACCUGUUUAAAAUAUGCAUGGCC----AGCUACUGAAGCAUAAUUUAUCUUUAUC-AUUCCAAUAAUAUGA ..........((((.(((((.(((..----..))).....))))).))))........-............... ( -4.80, z-score = 1.42, R) >consensus UACACCUGCUUAAUUUAUGCUCGACC____AGCUACUGCAGCAUAAAUUAUCUUUAUC_AUUCCCAUAAUAUUA ..........(((((((((((..........((....)))))))))))))........................ ( -8.23 = -8.45 + 0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:10:35 2011