| Sequence ID | dm3.chr2L |
|---|---|
| Location | 9,814,002 – 9,814,096 |
| Length | 94 |
| Max. P | 0.704305 |
| Location | 9,814,002 – 9,814,096 |
|---|---|
| Length | 94 |
| Sequences | 5 |
| Columns | 110 |
| Reading direction | reverse |
| Mean pairwise identity | 62.23 |
| Shannon entropy | 0.66260 |
| G+C content | 0.50083 |
| Mean single sequence MFE | -18.16 |
| Consensus MFE | -6.74 |
| Energy contribution | -7.30 |
| Covariance contribution | 0.56 |
| Combinations/Pair | 1.40 |
| Mean z-score | -1.40 |
| Structure conservation index | 0.37 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.46 |
| SVM RNA-class probability | 0.704305 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 9814002 94 - 23011544 CCUAAAUCCCCACCUCAUCCCACAACUAAAAAAAGC-UGCGUUCCA--GCCAGGUGGCAAAGAGAACCU-----------GGACACCAGCUGCCACCACCCACCACCA-- ..................................((-((.....))--))..(((((((........((-----------((...)))).)))))))...........-- ( -17.70, z-score = -1.31, R) >droSim1.chr2L 9595499 106 - 22036055 CCUAAAUCCCCACCUCAUCCCACAACUAAAACAGCUGUGCGUUCCA--GCCAGGUGGCAAAGAGAACCUUCACUUUGCCUGGACACCAGUUGCCACCACCCAACACCA-- .................................((((.......))--))..((((((((((((........))))..((((...))))))))))))...........-- ( -21.50, z-score = -1.07, R) >droSec1.super_3 5260709 97 - 7220098 -------CCCCACCUCAUCCCACAACUAAAACAGC--UGCGAUCCA--GCCAGGUGGCAAAGAGAACCUUCACUUUGUCUGGACACCAGUUGCCACCACCCAACACCA-- -------..........................((--((.....))--))..((((((((((((........))))..((((...))))))))))))...........-- ( -21.30, z-score = -1.69, R) >droEre2.scaffold_4929 10426193 96 - 26641161 CCUAAAUCCCCACCUCAUCCCACAACUAAAGCAGC--UGCGUUCCA--GCCAGGUGCCAA----AACUU------UGUCUGGACACCGGCUGUCACCACCCAACACCACC ..............................(((((--((.((((((--((.((((.....----.))))------.).))))).)))))))))................. ( -21.60, z-score = -2.33, R) >droGri2.scaffold_15126 6739268 92 - 8399593 ------------CCUAAUACCA-AACCAUUCCAACUUAAUGUUAAAUUCCCCAACAAAAAUUGGACUUUGUUGGCUUAAUAAAUACUAUUU-CCAUCAUUUCGUUU---- ------------..........-................((((((.....((((((((........)))))))).))))))..........-..............---- ( -8.70, z-score = -0.58, R) >consensus CCUAAAUCCCCACCUCAUCCCACAACUAAAACAGC__UGCGUUCCA__GCCAGGUGGCAAAGAGAACCU______UGUCUGGACACCAGUUGCCACCACCCAACACCA__ ....................................................((((((((......((............)).......))))))))............. ( -6.74 = -7.30 + 0.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:29:02 2011