| Sequence ID | dm3.chrX |
|---|---|
| Location | 2,666,547 – 2,666,622 |
| Length | 75 |
| Max. P | 0.870950 |
| Location | 2,666,547 – 2,666,622 |
|---|---|
| Length | 75 |
| Sequences | 7 |
| Columns | 83 |
| Reading direction | reverse |
| Mean pairwise identity | 68.50 |
| Shannon entropy | 0.56788 |
| G+C content | 0.28702 |
| Mean single sequence MFE | -13.01 |
| Consensus MFE | -4.69 |
| Energy contribution | -5.39 |
| Covariance contribution | 0.70 |
| Combinations/Pair | 1.60 |
| Mean z-score | -2.13 |
| Structure conservation index | 0.36 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.00 |
| SVM RNA-class probability | 0.870950 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 2666547 75 - 22422827 ----UUCACCAGCUA-AAAUCAUUAUGAUUUCCAGCGAA-AUUUGUUGGAAAAGUUG--GAAAUUAAUUAGGUGAAAGGAAAG ----((((((...((-(.....)))(((((((((((...-.............))))--)))))))....))))))....... ( -17.49, z-score = -2.71, R) >droSec1.super_10 2426774 75 - 3036183 ----UUCACCAGCCA-AAAUCAUUAUGAUUUCCAGCGAA-AUUUGUUGGAAAAGUUG--GAAAUUAAUUAGGUGAAAGGAAAA ----((((((..(((-(..((.....))((((((((((.-..))))))))))..)))--)..........))))))....... ( -17.60, z-score = -2.44, R) >droYak2.chrX 16089356 75 + 21770863 ----UUUACCAGCUA-AAAUCAUUAUAAUUUCCAGCGAA-AUUUGUUGGAAAAGCUG--GAAAUUAAUUAGGUGAAAGGAAAA ----....((((((.-............((((((((((.-..)))))))))))))))--)....................... ( -17.61, z-score = -2.86, R) >droEre2.scaffold_4690 93362 75 - 18748788 ----UUCACUAGCUA-AAAUCAUUAUAAUUUCCAGCGAA-AUUUGUUGGAAAAGUUG--GAAAUUAAUUAGGUGAAAGGAAAA ----((((((...((-(.....)))(((((((((((...-.............))))--)))))))....))))))....... ( -14.79, z-score = -2.13, R) >droAna3.scaffold_13248 4446003 83 + 4840945 CCACAAAAACAACAACAAAUUAUUACAAUUUUCAAAGGACACUUUUUGGAAAAAGUAACAAAAUUAAUUUAGUGAGAGGAAAG ............((..((((((((((..((((((((((....))))))))))..))))......))))))..))......... ( -8.80, z-score = -0.75, R) >dp4.chrXL_group1e 2052149 73 - 12523060 ----CCUAAUAAAGA-AACGUACUGUAAAUGAAGAUGAA-AGCUAAUGAAAAA-GG---AAAAAUAAGUACGUUUAAAGAAAG ----..........(-((((((((...............-.............-..---.......)))))))))........ ( -8.29, z-score = -2.72, R) >droPer1.super_18 906286 74 - 1952607 ----CCUAAUAAAGA-AACGUAUUAUAAAUGAAGAUGAA-GUCUAAUGAAAAAGGG---AAAAAUAAGUACGUUUAAAGAAAG ----..........(-((((((((........((((...-))))..(....)....---.......)))))))))........ ( -6.50, z-score = -1.26, R) >consensus ____UUCACCAGCUA_AAAUCAUUAUAAUUUCCAGCGAA_AUUUGUUGGAAAAGGUG__GAAAUUAAUUAGGUGAAAGGAAAG ............................((((((((((....))))))))))............................... ( -4.69 = -5.39 + 0.70)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:10:06 2011