| Sequence ID | dm3.chrX |
|---|---|
| Location | 2,549,198 – 2,549,250 |
| Length | 52 |
| Max. P | 0.604710 |
| Location | 2,549,198 – 2,549,250 |
|---|---|
| Length | 52 |
| Sequences | 5 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 96.18 |
| Shannon entropy | 0.06811 |
| G+C content | 0.56335 |
| Mean single sequence MFE | -12.74 |
| Consensus MFE | -11.52 |
| Energy contribution | -11.76 |
| Covariance contribution | 0.24 |
| Combinations/Pair | 1.09 |
| Mean z-score | -1.52 |
| Structure conservation index | 0.90 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.23 |
| SVM RNA-class probability | 0.604710 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 2549198 52 - 22422827 AGCCAACACGCGAUUAGUGAAUGCCC-AACCCUGGUGGCAACCGCCACCCAAU .((...(((.......)))...))..-......((((((....)))))).... ( -14.00, z-score = -1.87, R) >droSim1.chrX_random 1324627 52 - 5698898 AGCCAACACGCGAUUAGUGAAUGCCC-AACCCUGGUGGCAACCGCCACCCAAU .((...(((.......)))...))..-......((((((....)))))).... ( -14.00, z-score = -1.87, R) >droSec1.super_10 2314828 52 - 3036183 AGCCAACACGCGAUUAGUGAAUGCCC-AACCCUGGUGGCAACCGCCACCCAAU .((...(((.......)))...))..-......((((((....)))))).... ( -14.00, z-score = -1.87, R) >droYak2.chrX 15967825 52 + 21770863 AGCCAACACGCGAUUAGUGAAUGCCC-AACCCUGGUGGCAACCACCACCCAAU .((...(((.......)))...))..-.....((((((...))))))...... ( -10.40, z-score = -0.78, R) >droEre2.scaffold_4644 2495492 53 - 2521924 AGCCAACACGCGAUUAGUGAAUGUCCAAACACUGGAGGCAACCGCCACCCAAU .(((..(((.......)))....((((.....))))))).............. ( -11.30, z-score = -1.22, R) >consensus AGCCAACACGCGAUUAGUGAAUGCCC_AACCCUGGUGGCAACCGCCACCCAAU .((...(((.......)))...)).........((((((....)))))).... (-11.52 = -11.76 + 0.24)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:09:43 2011