| Sequence ID | dm3.chrX |
|---|---|
| Location | 2,338,607 – 2,338,698 |
| Length | 91 |
| Max. P | 0.731353 |
| Location | 2,338,607 – 2,338,698 |
|---|---|
| Length | 91 |
| Sequences | 5 |
| Columns | 117 |
| Reading direction | forward |
| Mean pairwise identity | 74.09 |
| Shannon entropy | 0.41277 |
| G+C content | 0.30994 |
| Mean single sequence MFE | -18.11 |
| Consensus MFE | -12.86 |
| Energy contribution | -12.86 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.20 |
| Structure conservation index | 0.71 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.53 |
| SVM RNA-class probability | 0.731353 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 2338607 91 + 22422827 UUCAAUAUUUAACUAAAACAAAACGAAGCAGCAUUAACGUUUAACGACUUAGCUGCUUAGCUGUUU-UUUUC-UUUUAAUUAAAC------GUUCUGCU------------------ ...((..(((((.(((((.(((((((((((((.....((.....)).....)))))))...)))))-)....-))))).))))).------.)).....------------------ ( -14.60, z-score = -0.46, R) >droEre2.scaffold_4644 2286889 111 + 2521924 AUCAAUCUCUACCUAAAACAAAAUCAAGCAGCAUUAGCGUUUAACGACUUAGCUGCUUAGGUGUUUAUUUUUUGUUUAAUUAUGA------AUUCAGACCAAUUUAAACGUUCUUCU .........((((((...........((((((...((((.....)).))..))))))))))))..........((((((...((.------...)).......))))))........ ( -17.70, z-score = -1.15, R) >droYak2.chrX 15762016 117 - 21770863 AUCAAUCUUUACCUUAAACAAAGUCAAGCAGCAUUAGCGUUUAACGACUUAGCUGCUUAGCUGUUUUUUUUUGCAUUAAUUAUGUCUGAAUGUUUAGACCAAAUUAAACGUUCUUCU .....................((..(((((((...((((.....)).))..)))))))..))..........((((.....))))..((((((((((......)))))))))).... ( -24.00, z-score = -2.04, R) >droSec1.super_10 2111043 92 + 3036183 UUCAAUAUUUACCUAAAACAAAACAAAGCAGCAUUAGCGUUUAACGACUUAGCUGCUUAGCUGUUU-UUUAAACGUAAAUUAAAC------GUUCUGCU------------------ ......((((((.......(((((((((((((...((((.....)).))..)))))))...)))))-)......)))))).....------........------------------ ( -17.12, z-score = -1.16, R) >droSim1.chrX 1656755 92 + 17042790 UUCAAUAUUUACCUAAAACAAAACAAAGCAGCAUUAGCGUUUAACGACUUAGCUGCUUAGCUGUUU-UUUAAACGUAAAUUAAAC------GUUCUGCU------------------ ......((((((.......(((((((((((((...((((.....)).))..)))))))...)))))-)......)))))).....------........------------------ ( -17.12, z-score = -1.16, R) >consensus UUCAAUAUUUACCUAAAACAAAACAAAGCAGCAUUAGCGUUUAACGACUUAGCUGCUUAGCUGUUU_UUUUAACGUUAAUUAAAC______GUUCUGCU__________________ ...............(((((.....(((((((.....((.....)).....)))))))...)))))................................................... (-12.86 = -12.86 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:09:09 2011