| Sequence ID | dm3.chrX |
|---|---|
| Location | 1,977,199 – 1,977,264 |
| Length | 65 |
| Max. P | 0.881405 |
| Location | 1,977,199 – 1,977,264 |
|---|---|
| Length | 65 |
| Sequences | 5 |
| Columns | 67 |
| Reading direction | forward |
| Mean pairwise identity | 69.18 |
| Shannon entropy | 0.54627 |
| G+C content | 0.48163 |
| Mean single sequence MFE | -19.12 |
| Consensus MFE | -9.44 |
| Energy contribution | -9.52 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.42 |
| Mean z-score | -1.59 |
| Structure conservation index | 0.49 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.05 |
| SVM RNA-class probability | 0.881405 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 1977199 65 + 22422827 --CCGCGGUCCAUGUGUGUGUGUGUGCUUACGAGUGCGAAUACUCACUCACAUCCUGUGCAAAUAAA --.(((((...(((((.(((.((((((........))..)))).))).))))).)))))........ ( -18.20, z-score = -1.26, R) >droSim1.chrX_random 1170730 61 + 5698898 --CCGCGGUGCAUGUGUGUGUGU----UUACGAGCGCGAAUACUCACUCACAUCCUGUGCAAAUAAA --.(((((.(.(((((.(((.((----...((....))...)).))).)))))))))))........ ( -16.90, z-score = -0.73, R) >droEre2.scaffold_4644 1949399 67 + 2521924 CCGCUUUCCACGUGUGUAUGUGUGUGCUUACGAGCGCGAAUACUCACUCACAUCCUGUGCAAAUAAA ...........(((.((((...((((((....)))))).)))).))).(((.....)))........ ( -15.50, z-score = -0.85, R) >droYak2.chrX 15422378 56 - 21770863 -----------AUGUGUGUGUGUGUGUUUACGAGCGCGAAUACUCACUCACAUCCUGCGCAAAUAAA -----------..(((((.(((.(((((..(....)..))))).))).))))).............. ( -15.30, z-score = -1.18, R) >droMoj3.scaffold_6473 16734165 52 - 16943266 ------------UGUGUGUGUGUGUGUGAAUUAGUGCAAACGCACGCACGCAGAC-ACACACACA-- ------------(((((((((.((((((.....((((....)))).)))))).))-)))))))..-- ( -29.70, z-score = -3.95, R) >consensus ___C______CAUGUGUGUGUGUGUGCUUACGAGCGCGAAUACUCACUCACAUCCUGUGCAAAUAAA ...........(((((.(((.((((..............)))).))).))))).............. ( -9.44 = -9.52 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:08:09 2011