| Sequence ID | dm3.chrX |
|---|---|
| Location | 1,698,216 – 1,698,268 |
| Length | 52 |
| Max. P | 0.963489 |
| Location | 1,698,216 – 1,698,268 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 93.27 |
| Shannon entropy | 0.11476 |
| G+C content | 0.29641 |
| Mean single sequence MFE | -10.43 |
| Consensus MFE | -9.80 |
| Energy contribution | -9.80 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.07 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.72 |
| SVM RNA-class probability | 0.963489 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 1698216 52 - 22422827 --AAAAAAUU---GAAGAAAAUGUAUACGAAAUUCGUUUUCAUUGCGUUUUCCACUG --........---...(((((((((...((((.....))))..)))))))))..... ( -9.80, z-score = -1.98, R) >droSec1.super_10 1493102 52 - 3036183 --AAAAAAUU---GAAGAAAAUGUAUACGAAAUUCGUUUUCAUUGCGUUUUCCACUG --........---...(((((((((...((((.....))))..)))))))))..... ( -9.80, z-score = -1.98, R) >droYak2.chrX 1543877 54 - 21770863 AAAAAAAAUU---GAAGAAAAUGUAUACGAAAUUCGUUUUCAUUGCGUUUUCCACUG ..........---...(((((((((...((((.....))))..)))))))))..... ( -9.80, z-score = -1.95, R) >droEre2.scaffold_4644 1675774 52 - 2521924 --AAAAAAUU---UAAGAAAAUGUAUACGAAAUUCGUUUUCAUUGCGUUUUCCACUG --........---...(((((((((...((((.....))))..)))))))))..... ( -9.80, z-score = -2.45, R) >dp4.chrXL_group1a 4287684 55 - 9151740 --AAAAAAUUCAAGAAGAAAAUGUAUACGAAAUGCGUUUUCAUUGCGUUUUCCGCUG --..............((((((((((.....))))))))))...(((.....))).. ( -11.70, z-score = -2.02, R) >droPer1.super_11 865077 55 - 2846995 --AAAAAAUUCAAGAAGAAAAUGUAUACGAAAUGCGUUUUCAUUGCGUUUUCCGCUG --..............((((((((((.....))))))))))...(((.....))).. ( -11.70, z-score = -2.02, R) >consensus __AAAAAAUU___GAAGAAAAUGUAUACGAAAUUCGUUUUCAUUGCGUUUUCCACUG ................(((((((((...((((.....))))..)))))))))..... ( -9.80 = -9.80 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:07:26 2011