| Sequence ID | dm3.chrX |
|---|---|
| Location | 1,596,127 – 1,596,180 |
| Length | 53 |
| Max. P | 0.955284 |
| Location | 1,596,127 – 1,596,180 |
|---|---|
| Length | 53 |
| Sequences | 7 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 78.55 |
| Shannon entropy | 0.41291 |
| G+C content | 0.39996 |
| Mean single sequence MFE | -11.51 |
| Consensus MFE | -8.32 |
| Energy contribution | -9.29 |
| Covariance contribution | 0.97 |
| Combinations/Pair | 1.50 |
| Mean z-score | -1.77 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.62 |
| SVM RNA-class probability | 0.955284 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 1596127 53 - 22422827 CCGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU-UACGUUGGCUUGUUAGUG .................((((((((((((.((...-.)).)))))))))))).. ( -13.70, z-score = -2.88, R) >droSim1.chrX_random 1060216 53 - 5698898 UCGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU-UACGUUGGCUUGUUAGUG .................((((((((((((.((...-.)).)))))))))))).. ( -13.70, z-score = -3.13, R) >droSec1.super_10 1401506 53 - 3036183 UCGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU-UACGUUGGCUUGUUAGUG .................((((((((((((.((...-.)).)))))))))))).. ( -13.70, z-score = -3.13, R) >droYak2.chrX 1449615 53 - 21770863 CUGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU-UACGUUGGCUUGUUAGUG .................((((((((((((.((...-.)).)))))))))))).. ( -13.70, z-score = -2.70, R) >droEre2.scaffold_4644 1583171 53 - 2521924 CCGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU-UACGUUGGCUUGUUAGUG .................((((((((((((.((...-.)).)))))))))))).. ( -13.70, z-score = -2.88, R) >droWil1.scaffold_181096 4520961 52 - 12416693 UUGGCGUUUUUAUUCAGUUAAGCAGCUCAA-UUGG-UAAGCAGCUUGGUUUAUG .................((((((.(((...-....-..))).))))))...... ( -6.40, z-score = 1.17, R) >droGri2.scaffold_14853 695538 53 - 10151454 CUGGCGUAUUUAUUAAGUUAAGCAGCUGAAAUUGUGUAAAGAUGCUUUUAUUU- ..(((((.(((((..((((....))))........))))).))))).......- ( -5.70, z-score = 1.13, R) >consensus CCGGCGUUUUCAUCAAGUUAGCAAGUCAAAGUUGU_UACGUUGGCUUGUUAGUG .................((((((((((((.((.....)).)))))))))))).. ( -8.32 = -9.29 + 0.97)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:06:58 2011