| Sequence ID | dm3.chrX |
|---|---|
| Location | 866,305 – 866,362 |
| Length | 57 |
| Max. P | 0.847899 |
| Location | 866,305 – 866,362 |
|---|---|
| Length | 57 |
| Sequences | 7 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 89.47 |
| Shannon entropy | 0.20728 |
| G+C content | 0.28157 |
| Mean single sequence MFE | -3.31 |
| Consensus MFE | -3.54 |
| Energy contribution | -3.21 |
| Covariance contribution | -0.32 |
| Combinations/Pair | 1.20 |
| Mean z-score | -0.55 |
| Structure conservation index | 1.07 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.90 |
| SVM RNA-class probability | 0.847899 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 866305 57 - 22422827 CACUUAUACACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAACAUGAAUUGCA ........................((((((.....))))))((((.......)))). ( -3.10, z-score = -1.24, R) >droYak2.chrX 783719 57 - 21770863 CACUUAUACACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAGCAUGAAUUGCA ........................((((((.....))))))((((.......)))). ( -3.90, z-score = -0.59, R) >droEre2.scaffold_4644 840695 57 - 2521924 CACUUAUACACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAGCAUGAGUUGCA ........................((((((.....))))))....(((.....))). ( -3.60, z-score = 0.28, R) >droAna3.scaffold_12929 631480 57 - 3277472 UACUUACAAACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGGACGCGACUCGCA ........................((((((.....))))))((((.......)))). ( -4.50, z-score = -1.80, R) >dp4.chrXL_group1a 3849180 57 + 9151740 UACUUACAUACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAACGUGAAUUGCA ........................((((((.....))))))((((.......)))). ( -3.10, z-score = -0.22, R) >droPer1.super_11 958439 57 + 2846995 UACUUACAUACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAACGUGAAUUGCA ........................((((((.....))))))((((.......)))). ( -3.10, z-score = -0.22, R) >droGri2.scaffold_15203 3915610 52 + 11997470 -----AUACACACAUUAACAUACAUAAUUACAAUUUAAUUAGCGGACAUGAAUUGCA -----.........................(((((((...........))))))).. ( -1.90, z-score = -0.08, R) >consensus CACUUAUACACACAUUAACAUACAUAAUUACAAAUUAAUUAGCGAACAUGAAUUGCA ........................((((((.....))))))((((.......)))). ( -3.54 = -3.21 + -0.32)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:04:32 2011