| Sequence ID | dm3.chrX |
|---|---|
| Location | 858,220 – 858,275 |
| Length | 55 |
| Max. P | 0.899108 |
| Location | 858,220 – 858,275 |
|---|---|
| Length | 55 |
| Sequences | 6 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 76.82 |
| Shannon entropy | 0.42618 |
| G+C content | 0.41742 |
| Mean single sequence MFE | -14.27 |
| Consensus MFE | -7.46 |
| Energy contribution | -7.55 |
| Covariance contribution | 0.09 |
| Combinations/Pair | 1.43 |
| Mean z-score | -2.12 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.14 |
| SVM RNA-class probability | 0.899108 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 858220 55 + 22422827 ----GUUUAUAUGUACUUAAGGGUAUUUGG-GAGCUCUCUUCCCCAAAGCUCUUCAUCAC ----..............((((((.(((((-(..........))))))))))))...... ( -11.20, z-score = -1.06, R) >droAna3.scaffold_12929 623659 60 + 3277472 GUCAAAUAAAAUAUAAAGCAGGGUAUAAACCAGGCUAUAAAUUUUAACAUUUUUUCACAA ......((((((.((.(((..(((....)))..))).)).)))))).............. ( -10.20, z-score = -3.56, R) >droEre2.scaffold_4644 833511 55 + 2521924 ----CUUUAUAGGUACUUAAGGGUAUUUGG-GGGCUCUCUUCCCCAAAGCUCUUCAUCAC ----.......(((....((((((.(((((-(((......)))))))))))))).))).. ( -16.10, z-score = -2.14, R) >droYak2.chrX 776241 55 + 21770863 ----CUUUAUGGGUACUUAAGGGUAUUUGG-GGGCUCUCUUCCCCAAAGCUCUUCAUCAC ----.......(((....((((((.(((((-(((......)))))))))))))).))).. ( -15.90, z-score = -1.70, R) >droSec1.super_10 699753 55 + 3036183 ----CUUUAUAGGUACUUAAGGGUAUUUGG-GGGCUCUCUUCCCCAAAGCUCUUCAUCAC ----.......(((....((((((.(((((-(((......)))))))))))))).))).. ( -16.10, z-score = -2.14, R) >droSim1.chrX 693107 55 + 17042790 ----CUUUAUAGGUACUUAAGGGUAUUUGG-GGGCUCUCUUCCCCAAAGCUCUUCAUCAC ----.......(((....((((((.(((((-(((......)))))))))))))).))).. ( -16.10, z-score = -2.14, R) >consensus ____CUUUAUAGGUACUUAAGGGUAUUUGG_GGGCUCUCUUCCCCAAAGCUCUUCAUCAC ..................((((((.(((((.(((......))))))))))))))...... ( -7.46 = -7.55 + 0.09)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:04:30 2011