| Sequence ID | dm3.chr4 |
|---|---|
| Location | 847,410 – 847,465 |
| Length | 55 |
| Max. P | 0.983952 |
| Location | 847,410 – 847,465 |
|---|---|
| Length | 55 |
| Sequences | 3 |
| Columns | 55 |
| Reading direction | forward |
| Mean pairwise identity | 93.33 |
| Shannon entropy | 0.09560 |
| G+C content | 0.32929 |
| Mean single sequence MFE | -10.59 |
| Consensus MFE | -10.81 |
| Energy contribution | -10.59 |
| Covariance contribution | -0.22 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.90 |
| Structure conservation index | 1.02 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.15 |
| SVM RNA-class probability | 0.983952 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr4 847410 55 + 1351857 UAUAUGACUGCUAAAAUUAAAACUGCGCUGUUUGAAUAUUGUUGAACGGCAUUCC .........((.............))((((((..(......)..))))))..... ( -10.12, z-score = -2.11, R) >droSim1.chr4 660777 55 + 949497 UAUAUGACUGCUAACAUUAAAACUGCGCUGUUUGAAUAUUGUUGAACAGCAUUUU .........((.............))((((((..(......)..))))))..... ( -10.82, z-score = -1.91, R) >droSec1.super_30 555594 54 + 664411 UAUAUGACGGCUAACAUUAAAACUGCGCUGUUUGAAUAUUGUUGAACAGCAUUU- .........((.............))((((((..(......)..))))))....- ( -10.82, z-score = -1.67, R) >consensus UAUAUGACUGCUAACAUUAAAACUGCGCUGUUUGAAUAUUGUUGAACAGCAUUU_ .........((.............))((((((..(......)..))))))..... (-10.81 = -10.59 + -0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:01:40 2011