| Sequence ID | dm3.chr4 |
|---|---|
| Location | 493,756 – 493,830 |
| Length | 74 |
| Max. P | 0.722602 |
| Location | 493,756 – 493,830 |
|---|---|
| Length | 74 |
| Sequences | 12 |
| Columns | 74 |
| Reading direction | forward |
| Mean pairwise identity | 65.94 |
| Shannon entropy | 0.77439 |
| G+C content | 0.36106 |
| Mean single sequence MFE | -14.00 |
| Consensus MFE | -5.55 |
| Energy contribution | -5.86 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.33 |
| Mean z-score | -0.86 |
| Structure conservation index | 0.40 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.722602 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr4 493756 74 + 1351857 UAAAAGUAUGACAAACCUGGUGUAAGAUCUGAUAUAUUAGGAGGACAUUCUAAGGCAAUGGAGUAAGUGGUUUU .......((.((...(((((((((........))))))))).....((((((......))))))..)).))... ( -12.30, z-score = -0.34, R) >droWil1.scaffold_181130 15165406 68 - 16660200 ------UAAAACAAACCUGGUGUCAAGUCCGUCAUAUUUGGAGGAUUCGGCAAAGCACCAGAACAUAGGACAUU ------..........((((((((.(((((..((....))..))))).).....)))))))............. ( -16.70, z-score = -2.05, R) >droGri2.scaffold_14822 845380 56 + 1097346 ---------GACAUACCUGGUGUUAAAUCCAUGAUAUUGGGGGAAUUUUGAAGUGCAUGGUGACU--------- ---------......((..((((((......))))))..)).................(....).--------- ( -10.60, z-score = 0.12, R) >droVir3.scaffold_13052 787958 69 - 2019633 --UAAGCAGGACCAACCUGGUGUUAGAUCCAUAAUAUUUGGAGAAUUUUGUAAUGCAUUAGAAUAAUGAGU--- --....((((.....))))((((((.(((((.......))))......).))))))...............--- ( -10.00, z-score = 0.02, R) >droMoj3.scaffold_6498 2281370 74 - 3408170 UAAGACAUUAACUAACCUGGUGUCAGGUCCAUAAUAUUUGGAGAGUUCUGUAAAACACUCGAAUAAAGUUGAAU .......((((((.(((((....)))))......((((((.((.(((......))).)))))))).)))))).. ( -14.00, z-score = -0.92, R) >droSim1.chr4 381576 74 + 949497 UAAAAGUAUGACAAACCUGGUGUAAGAUCUGAUAUAUUAGGAGGGCAUUCUAAAGCAAUGGAGUAAGUGGUUUU .......((.((...(((((((((........))))))))).....((((((......))))))..)).))... ( -12.30, z-score = -0.37, R) >droSec1.super_30 221430 74 + 664411 UAAAAGUAUGACAAACCUGGUGUAAGAUCUGAUAUAUUAGGAGGGCAUUCUAAAGCAAUGGAGUAAGUGGUUUU .......((.((...(((((((((........))))))))).....((((((......))))))..)).))... ( -12.30, z-score = -0.37, R) >droYak2.chr4 540687 74 + 1374474 UAAAAGUUUUACAAACCUGGUGUAAGAUCCGUUAUAUUAGGGGGAUAUUCUAAAGCAAUGGAGUAAGUGGUUUU ........((((...((((((((((......))))))))))....(((((((......))))))).)))).... ( -15.10, z-score = -1.35, R) >droEre2.scaffold_4512 491557 74 - 1286254 UAAAUAUUUGGCACACCUGGUGUAAGAUCCGUUAUAUUAGGAGGAUAUUCUAAAGCAAUGGAGUAAGUGGUUUU ...........(((.((((((((((......))))))))))....(((((((......))))))).)))..... ( -16.70, z-score = -1.65, R) >droAna3.scaffold_13099 3032142 74 + 3324263 GACAAUUAUUACUGACCUGGUGUAAGAUCCUUAAUAUUGGAUGGAUUUUCUAAACCAAUGAAGUAUUUGUUAAU (((((....((((....((((..(((((((............)))))))....))))....)))).)))))... ( -15.60, z-score = -1.87, R) >dp4.Unknown_group_78 1103 74 - 77267 UAUAAAGGGAACAAACCUGGUGUUAGGUCCGUAUUAUUGGGAGGAUUUUGUAAAACACCAGAGUAUAUGUCGUG ........((....((((((((((((((((............)))))).....)))))))).)).....))... ( -16.20, z-score = -0.74, R) >droPer1.super_42 215354 74 - 623919 UAUAAAGGGAACAAACCUGGUGUUAGGUCCGUAUUAUUGGGAGGAUUUUGUAAAACACCAGAGUAUAUGUCGUG ........((....((((((((((((((((............)))))).....)))))))).)).....))... ( -16.20, z-score = -0.74, R) >consensus UAAAAGUAUGACAAACCUGGUGUAAGAUCCGUAAUAUUAGGAGGAUUUUCUAAAGCAAUGGAGUAAGUGGUUUU ...............(((((((((........)))))))))................................. ( -5.55 = -5.86 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:01:09 2011